Rmu_sc0004646.1_g000018

Probable lipid transfer

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004646.1
Physical Location & Seq
Forward (+)
75025 .. 75412
388 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004646.1_g000018.1.cds

Sequence Viewer

Length: 309 bp
atggcatgcttattgttcttggtgggtgtttgggatgtggttccggtagcaatgggggacacgacaccgagccagtgtaaggaggagaaaaagcttctcgttgatgcgtgcaaggcagttgttacaggaagtgatccctctgcatactgctgccaacgccttaaggtcactcatgttgagtgtgtatgcccctatgttactcccaagcttgccaatctgctcaacgtcccacgtatcattaagcaaattgaaggttgcggaaggaccgttcctcacaacttcaagtgtggaagtatcaccactccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.05

Weight (kDa)

8.4

Isoelectric Point (pI)

36.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 258
AclWI GGATC 1 cut(s) 128
AfiI CCNNNNNNNGG 1 cut(s) 79
AflII CTTAAG 1 cut(s) 161
AgsI TTSAA 2 cut(s) 251, 283
AloI GAACNNNNNNTCC 2 cut(s) 252, 284
AluBI AGCT 2 cut(s) 94, 208
AluI AGCT 2 cut(s) 94, 208
AlwI GGATC 1 cut(s) 128
ApeKI GCWGC 1 cut(s) 150
AspS9I GGNCC 1 cut(s) 264
AsuHPI GGTGA 1 cut(s) 289
AvaII GGWCC 1 cut(s) 264
BbvI GCAGC 1 cut(s) 137
BfrI CTTAAG 1 cut(s) 161
BisI GCNGC 1 cut(s) 151
BlsI GCNGC 1 cut(s) 152
Bme18I GGWCC 1 cut(s) 264
BmgT120I GGNCC 1 cut(s) 264
BmiI GGNNCC 1 cut(s) 42
BmsI GCATC 1 cut(s) 94
BsaAI YACGTR 1 cut(s) 233
BsaWI WCCGGW 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse1I ACTGG 1 cut(s) 73
Bse3DI GCAATG 1 cut(s) 57
BseGI GGATG 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMI GCAATG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 73
BseRI GAGGAG 1 cut(s) 98
BseXI GCAGC 1 cut(s) 137
BsiSI CCGG 1 cut(s) 44
BslFI GGGAC 2 cut(s) 71, 212
BslI CCNNNNNNNGG 1 cut(s) 79
BsmFI GGGAC 2 cut(s) 71, 212
Bsp143I GATC 1 cut(s) 133
BspACI CCGC 1 cut(s) 258
BspLI GGNNCC 1 cut(s) 42
BspPI GGATC 1 cut(s) 128
BspTI CTTAAG 1 cut(s) 161
BsrDI GCAATG 1 cut(s) 57
BsrI ACTGG 1 cut(s) 73
BssMI GATC 1 cut(s) 133
Bst4CI ACNGT 1 cut(s) 268
BstAFI CTTAAG 1 cut(s) 161
BstBAI YACGTR 1 cut(s) 233
BstC8I GCNNGC 3 cut(s) 7, 109, 210
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstMWI GCNNNNNNNGC 2 cut(s) 113, 156
BstNSI RCATGY 1 cut(s) 9
BstV1I GCAGC 1 cut(s) 137
BtsCI GGATG 1 cut(s) 40
BtsIMutI CAGTG 1 cut(s) 80
Cac8I GCNNGC 3 cut(s) 7, 109, 210
Cfr13I GGNCC 1 cut(s) 264
CviAII CATG 3 cut(s) 6, 173, 306
CviJI RGCY 3 cut(s) 72, 94, 208
CviKI_1 RGCY 3 cut(s) 72, 94, 208
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
Eco47I GGWCC 1 cut(s) 264
FaeI CATG 3 cut(s) 9, 176, 309
FaiI YATR 6 cut(s) 7, 145, 174, 187, 195, 307
FaqI GGGAC 2 cut(s) 71, 212
FatI CATG 3 cut(s) 5, 172, 305
Fnu4HI GCNGC 1 cut(s) 151
FokI GGATG 1 cut(s) 47
Fsp4HI GCNGC 1 cut(s) 151
GluI GCNGC 1 cut(s) 151
HapII CCGG 1 cut(s) 44
Hin1II CATG 3 cut(s) 9, 176, 309
HindIII AAGCTT 2 cut(s) 92, 206
HpaII CCGG 1 cut(s) 44
HphI GGTGA 1 cut(s) 289
HpyAV CCTTC 2 cut(s) 245, 255
HpyCH4III ACNGT 1 cut(s) 268
HpyCH4IV ACGT 2 cut(s) 225, 232
HpyCH4V TGCA 2 cut(s) 111, 143
HpyF10VI GCNNNNNNNGC 2 cut(s) 113, 156
HpySE526I ACGT 2 cut(s) 225, 232
Hsp92II CATG 3 cut(s) 9, 176, 309
Kzo9I GATC 1 cut(s) 133
LpnPI CCDG 3 cut(s) 57, 86, 111
Lsp1109I GCAGC 1 cut(s) 137
LweI GCATC 1 cut(s) 94
MaeII ACGT 2 cut(s) 225, 232
MaeIII GTNAC 3 cut(s) 121, 166, 196
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MluCI AATT 1 cut(s) 246
MnlI CCTC 3 cut(s) 76, 148, 282
MseI TTAA 2 cut(s) 162, 240
MspCI CTTAAG 1 cut(s) 161
MspI CCGG 1 cut(s) 44
MwoI GCNNNNNNNGC 2 cut(s) 113, 156
NdeII GATC 1 cut(s) 133
NlaIII CATG 3 cut(s) 9, 176, 309
NlaIV GGNNCC 1 cut(s) 42
NmuCI GTSAC 1 cut(s) 166
NspI RCATGY 1 cut(s) 9
PaeI GCATGC 1 cut(s) 9
PkrI GCNGC 1 cut(s) 152
Ppu21I YACGTR 1 cut(s) 233
PspN4I GGNNCC 1 cut(s) 42
PspPI GGNCC 1 cut(s) 264
SaqAI TTAA 2 cut(s) 162, 240
SatI GCNGC 1 cut(s) 151
Sau3AI GATC 1 cut(s) 133
Sau96I GGNCC 1 cut(s) 264
SetI ASST 6 cut(s) 96, 168, 210, 228, 235, 256
SfaNI GCATC 1 cut(s) 94
SinI GGWCC 1 cut(s) 264
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
SphI GCATGC 1 cut(s) 9
Sse9I AATT 1 cut(s) 246
SsiI CCGC 1 cut(s) 258
TaaI ACNGT 1 cut(s) 268
TaiI ACGT 2 cut(s) 228, 235
TasI AATT 1 cut(s) 246
Tru1I TTAA 2 cut(s) 162, 240
Tru9I TTAA 2 cut(s) 162, 240
TscAI CASTG 1 cut(s) 80
TseFI GTSAC 1 cut(s) 166
TseI GCWGC 1 cut(s) 150
Tsp45I GTSAC 1 cut(s) 166
TspRI CASTG 1 cut(s) 80
Vha464I CTTAAG 1 cut(s) 161
VpaK11BI GGWCC 1 cut(s) 264
XceI RCATGY 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.