Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004670.1

Orthogroup ID

OG0014636

Physical Location & Seq

Genomic Coordinates Reverse (-)

55035 .. 57940

Gene Structure 2906 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004670.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1179 bp

atggatgctgcagataacagggcaagagatgttgtagctgtgaaagagaagttggctgaagaacttagggaaaagttagctcaatccaagcaaaataagagatctaggggaggggggaagaaaccaaatgagccaaggtataatataagagggaaaggaaaaggcagcaatgcaagagttgaagaggtagttgatgatgatggttcagacttctatgtcgattcagattatgatctcaaccatgatgagtttgatgatgctgaatttgaagaaaacatcatagaacaaagagtggttgaggagtttgaagatatgggtttcaaaggctattgttcagacgaagctggagattctaataagttagagagtttgagtcggactttgaacaacaagcgcatatgttctcaagtggaaacaagccatttcttggattataacaggattgcaacagaggtgcaagaagatctgctggtggataagaagtggtctagagctggcatccatagttggtttccaaatgttgaatataagcactgtgtgaggcatctctacaacaatttcaagaccaaccatccaagagaggggctgaagcagttggtttggaatgtagctagatccagcattgttgtgtggtacaacaagcacatggttgaattgagggagcttattgatgatgcttggaaatggtttcaggacaagaatccagcacagtggtttagggcctatttcagagtaggccaagaggattggcaacctgttgagtacccaattgcacctccactttacaaacagcagcctggtaggcctaaaatgaagaggttaaaggaaccaggaaagaggaaacagaccacagcccctgcacccaaagagggtaaattgcctagaattggtatcaaaatttcatgtagaggagaaagttcatcaaatggaccaaatactggtaacaagaggaagataaccaacaacaaggagcatatcataaagtcaaggaagacatggcagaaggtcaaggatgttgttggtggtacttctggtatcaataataatgcatcaacctcacaaaaagtgcagcaacctcctagtcaaagcagccaaaatcctgctgcaaaaggtgcacagaagaaatcatcccagcctatgcaaccaagccaagcttcctctgaatgggctggtttttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DBD_Tnp_Mut MULE SWIM

Protein Analysis

392

Amino Acids

44.9

Weight (kDa)

9.23

Isoelectric Point (pI)

48.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014636)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g11351
rosa_laevigata	RLG00000006487
rosa_multiflora	Rmu_sc0000073.1_g000011 Rmu_sc0004670.1_g000011 Rmu_ssc0000438.1_g000045
rosa_roxburghii	Rroxscaffold_4G00308140
rosa_rugosa	Rorug03G0261300
rosa_samantha	Rh2AG374900 Rh2AG429000 Rh2CG414600 Rh2CG442800 Rh3DG234800 Rh3DG253100 Rh4BG360500 Rh4DG248400 Rh6CG186500 Rh6DG178100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	435
AasI	GACNNNNNNGTC	1 cut(s)	215
AccB7I	CCANNNNNTGG	2 cut(s)	427, 938
AclWI	GGATC	1 cut(s)	609
AcsI	RAATTY	2 cut(s)	263, 897
AcuI	CTGAAG	2 cut(s)	78, 608
AdeI	CACNNNGTG	1 cut(s)	538
AfaI	GTAC	3 cut(s)	635, 764, 1027
AfiI	CCNNNNNNNGG	6 cut(s)	427, 581, 869, 887, 938, 1164
AgsI	TTSAA	8 cut(s)	182, 269, 308, 322, 385, 524, 562, 653
AjnI	CCWGG	2 cut(s)	796, 829
AjuI	GAANNNNNNNTTGG	4 cut(s)	35, 67, 1138, 1170
AluBI	AGCT	7 cut(s)	38, 80, 344, 494, 611, 664, 1154
AluI	AGCT	7 cut(s)	38, 80, 344, 494, 611, 664, 1154
Alw21I	GWGCWC	1 cut(s)	1117
Alw44I	GTGCAC	1 cut(s)	1113
AlwI	GGATC	1 cut(s)	609
AlwNI	CAGNNNCTG	1 cut(s)	857
AoxI	GGCC	3 cut(s)	720, 736, 803
ApaLI	GTGCAC	1 cut(s)	1113
ApeKI	GCWGC	6 cut(s)	8, 165, 793, 1069, 1089, 1103
ApoI	RAATTY	2 cut(s)	263, 897
AspLEI	GCGC	1 cut(s)	396
AspS9I	GGNCC	2 cut(s)	720, 929
AvaII	GGWCC	1 cut(s)	929
BaeGI	GKGCMC	1 cut(s)	1117
BbsI	GAAGAC	1 cut(s)	998
Bbv12I	GWGCWC	1 cut(s)	1117
BbvI	GCAGC	5 cut(s)	177, 805, 1081, 1090, 1101
BccI	CCATC	2 cut(s)	194, 579
BciT130I	CCWGG	2 cut(s)	798, 831
BfaI	CTAG	5 cut(s)	105, 489, 612, 882, 1080
BfmI	CTRYAG	1 cut(s)	9
BglI	GCCNNNNNGGC	1 cut(s)	802
BglII	AGATCT	2 cut(s)	101, 463
BisI	GCNGC	6 cut(s)	9, 166, 794, 1070, 1090, 1104
BlsI	GCNGC	6 cut(s)	10, 167, 795, 1071, 1091, 1105
Bme1390I	CCNGG	2 cut(s)	798, 831
Bme18I	GGWCC	1 cut(s)	929
BmgT120I	GGNCC	2 cut(s)	720, 929
BmiI	GGNNCC	1 cut(s)	828
BmrFI	CCNGG	2 cut(s)	798, 831
BmsI	GCATC	5 cut(s)	247, 507, 553, 664, 1058
BpiI	GAAGAC	1 cut(s)	998
BpmI	CTGGAG	1 cut(s)	366
BpuEI	CTTGAG	1 cut(s)	390
BsaBI	GATNNNNATC	1 cut(s)	231
BsaJI	CCNNGG	1 cut(s)	134
Bsc4I	CCNNNNNNNGG	6 cut(s)	427, 581, 869, 887, 938, 1164
Bse1I	ACTGG	1 cut(s)	943
Bse3DI	GCAATG	1 cut(s)	175
Bse8I	GATNNNNATC	1 cut(s)	231
BseBI	CCWGG	2 cut(s)	798, 831
BseDI	CCNNGG	1 cut(s)	134
BseGI	GGATG	5 cut(s)	10, 498, 571, 1018, 1127
BseJI	GATNNNNATC	1 cut(s)	231
BseLI	CCNNNNNNNGG	6 cut(s)	427, 581, 869, 887, 938, 1164
BseMI	GCAATG	1 cut(s)	175
BseNI	ACTGG	1 cut(s)	943
BseRI	GAGGAG	2 cut(s)	314, 924
BseSI	GKGCMC	1 cut(s)	1117
BseXI	GCAGC	5 cut(s)	177, 805, 1081, 1090, 1101
BseYI	CCCAGC	1 cut(s)	1131
BsgI	GTGCAG	2 cut(s)	843, 1088
BshFI	GGCC	3 cut(s)	722, 738, 805
BsiHKAI	GWGCWC	1 cut(s)	1117
BslI	CCNNNNNNNGG	6 cut(s)	427, 581, 869, 887, 938, 1164
BsnI	GGCC	3 cut(s)	722, 738, 805
Bsp1286I	GDGCHC	1 cut(s)	1117
Bsp143I	GATC	4 cut(s)	101, 232, 463, 614
BspANI	GGCC	3 cut(s)	722, 738, 805
BspLI	GGNNCC	1 cut(s)	828
BspMAI	CTGCAG	1 cut(s)	13
BspPI	GGATC	1 cut(s)	609
BsrDI	GCAATG	1 cut(s)	175
BsrI	ACTGG	1 cut(s)	943
BssECI	CCNNGG	1 cut(s)	134
BssMI	GATC	4 cut(s)	101, 232, 463, 614
BssT1I	CCWWGG	1 cut(s)	134
Bst2UI	CCWGG	2 cut(s)	798, 831
Bst4CI	ACNGT	2 cut(s)	536, 711
Bst6I	CTCTTC	2 cut(s)	177, 809
BstAPI	GCANNNNNTGC	1 cut(s)	1112
BstC8I	GCNNGC	1 cut(s)	496
BstDEI	CTNAG	1 cut(s)	65
BstF5I	GGATG	5 cut(s)	10, 498, 571, 1018, 1127
BstHHI	GCGC	1 cut(s)	396
BstKTI	GATC	4 cut(s)	104, 235, 466, 617
BstMBI	GATC	4 cut(s)	101, 232, 463, 614
BstMWI	GCNNNNNNNGC	2 cut(s)	802, 1112
BstNI	CCWGG	2 cut(s)	798, 831
BstSCI	CCNGG	2 cut(s)	796, 829
BstSFI	CTRYAG	1 cut(s)	9
BstSLI	GKGCMC	1 cut(s)	1117
BstV1I	GCAGC	5 cut(s)	177, 805, 1081, 1090, 1101
BstV2I	GAAGAC	1 cut(s)	998
BstX2I	RGATCY	3 cut(s)	101, 463, 614
BstXI	CCANNNNNNTGG	1 cut(s)	711
BstYI	RGATCY	3 cut(s)	101, 463, 614
BsuRI	GGCC	3 cut(s)	722, 738, 805
BtsCI	GGATG	5 cut(s)	10, 498, 571, 1018, 1127
BtsIMutI	CAGTG	2 cut(s)	532, 716
Cac8I	GCNNGC	1 cut(s)	496
CaiI	CAGNNNCTG	1 cut(s)	857
CfoI	GCGC	1 cut(s)	396
Cfr13I	GGNCC	2 cut(s)	720, 929
Csp6I	GTAC	3 cut(s)	634, 763, 1026
CviAII	CATG	4 cut(s)	242, 646, 903, 996
CviQI	GTAC	3 cut(s)	634, 763, 1026
DdeI	CTNAG	1 cut(s)	65
DpnI	GATC	4 cut(s)	103, 234, 465, 616
DpnII	GATC	4 cut(s)	101, 232, 463, 614
DraIII	CACNNNGTG	1 cut(s)	538
DrdI	GACNNNNNNGTC	1 cut(s)	215
DseDI	GACNNNNNNGTC	1 cut(s)	215
Eam1104I	CTCTTC	2 cut(s)	177, 809
EarI	CTCTTC	2 cut(s)	177, 809
Eco130I	CCWWGG	1 cut(s)	134
Eco147I	AGGCCT	1 cut(s)	805
Eco47I	GGWCC	1 cut(s)	929
Eco57I	CTGAAG	2 cut(s)	78, 608
EcoO109I	RGGNCCY	1 cut(s)	720
EcoRII	CCWGG	2 cut(s)	796, 829
EcoT14I	CCWWGG	1 cut(s)	134
EcoT22I	ATGCAT	1 cut(s)	1051
ErhI	CCWWGG	1 cut(s)	134
FaeI	CATG	4 cut(s)	245, 649, 906, 999
FalI	AAGNNNNNCTT	2 cut(s)	1138, 1170
FatI	CATG	4 cut(s)	241, 645, 902, 995
FauNDI	CATATG	1 cut(s)	398
Fnu4HI	GCNGC	6 cut(s)	9, 166, 794, 1070, 1090, 1104
FokI	GGATG	5 cut(s)	17, 485, 558, 1025, 1114
Fsp4HI	GCNGC	6 cut(s)	9, 166, 794, 1070, 1090, 1104
FspBI	CTAG	5 cut(s)	105, 489, 612, 882, 1080
GlaI	GCGC	1 cut(s)	395
GluI	GCNGC	6 cut(s)	9, 166, 794, 1070, 1090, 1104
GsaI	CCCAGC	1 cut(s)	1135
GsuI	CTGGAG	1 cut(s)	366
HaeIII	GGCC	3 cut(s)	722, 738, 805
HhaI	GCGC	1 cut(s)	396
Hin1II	CATG	4 cut(s)	245, 649, 906, 999
Hin6I	GCGC	1 cut(s)	394
HinP1I	GCGC	1 cut(s)	394
HindIII	AAGCTT	1 cut(s)	1152
HinfI	GANTC	4 cut(s)	221, 350, 373, 700
Hpy166II	GTNNAC	1 cut(s)	1115
Hpy188I	TCNGA	6 cut(s)	208, 226, 337, 378, 731, 1162
Hpy188III	TCNNGA	3 cut(s)	489, 562, 692
Hpy8I	GTNNAC	1 cut(s)	1115
HpyAV	CCTTC	1 cut(s)	997
HpyCH4III	ACNGT	2 cut(s)	536, 711
HpyF10VI	GCNNNNNNNGC	2 cut(s)	802, 1112
HpyF3I	CTNAG	1 cut(s)	65
Hsp92II	CATG	4 cut(s)	245, 649, 906, 999
HspAI	GCGC	1 cut(s)	394
Kzo9I	GATC	4 cut(s)	101, 232, 463, 614
LmnI	GCTCC	2 cut(s)	661, 970
Lsp1109I	GCAGC	5 cut(s)	177, 805, 1081, 1090, 1101
LweI	GCATC	5 cut(s)	247, 507, 553, 664, 1058
MaeI	CTAG	5 cut(s)	105, 489, 612, 882, 1080
MaeIII	GTNAC	1 cut(s)	941
MalI	GATC	4 cut(s)	103, 234, 465, 616
MboI	GATC	4 cut(s)	101, 232, 463, 614
MfeI	CAATTG	1 cut(s)	768
MflI	RGATCY	3 cut(s)	101, 463, 614
MhlI	GDGCHC	1 cut(s)	1117
MluCI	AATT	7 cut(s)	263, 556, 653, 768, 875, 885, 897
MlyI	GAGTC	1 cut(s)	382
MmeI	TCCRAC	1 cut(s)	356
Mph1103I	ATGCAT	1 cut(s)	1051
MseI	TTAA	2 cut(s)	821, 1177
MslI	CAYNNNNRTG	1 cut(s)	626
MspR9I	CCNGG	2 cut(s)	798, 831
MunI	CAATTG	1 cut(s)	768
MvaI	CCWGG	2 cut(s)	798, 831
MwoI	GCNNNNNNNGC	2 cut(s)	802, 1112
NdeI	CATATG	1 cut(s)	398
NdeII	GATC	4 cut(s)	101, 232, 463, 614
NlaIII	CATG	4 cut(s)	245, 649, 906, 999
NlaIV	GGNNCC	1 cut(s)	828
NsiI	ATGCAT	1 cut(s)	1051
PceI	AGGCCT	1 cut(s)	805
PfeI	GAWTC	3 cut(s)	221, 350, 700
PflMI	CCANNNNNTGG	2 cut(s)	427, 938
PkrI	GCNGC	6 cut(s)	10, 167, 795, 1071, 1091, 1105
PleI	GAGTC	1 cut(s)	381
PpsI	GAGTC	1 cut(s)	381
PsiI	TTATAA	1 cut(s)	435
Psp6I	CCWGG	2 cut(s)	796, 829
PspFI	CCCAGC	1 cut(s)	1131
PspGI	CCWGG	2 cut(s)	796, 829
PspN4I	GGNNCC	1 cut(s)	828
PspPI	GGNCC	2 cut(s)	720, 929
PstI	CTGCAG	1 cut(s)	13
PstNI	CAGNNNCTG	1 cut(s)	857
PsuI	RGATCY	3 cut(s)	101, 463, 614
RsaI	GTAC	3 cut(s)	635, 764, 1027
RsaNI	GTAC	3 cut(s)	634, 763, 1026
RseI	CAYNNNNRTG	1 cut(s)	626
SaqAI	TTAA	2 cut(s)	821, 1177
SatI	GCNGC	6 cut(s)	9, 166, 794, 1070, 1090, 1104
Sau3AI	GATC	4 cut(s)	101, 232, 463, 614
Sau96I	GGNCC	2 cut(s)	720, 929
SchI	GAGTC	1 cut(s)	382
ScrFI	CCNGG	2 cut(s)	798, 831
SduI	GDGCHC	1 cut(s)	1117
SfaNI	GCATC	5 cut(s)	247, 507, 553, 664, 1058
SfcI	CTRYAG	1 cut(s)	9
SinI	GGWCC	1 cut(s)	929
SmiMI	CAYNNNNRTG	1 cut(s)	626
SmlI	CTYRAG	1 cut(s)	405
SmoI	CTYRAG	1 cut(s)	405
Sse9I	AATT	7 cut(s)	263, 556, 653, 768, 875, 885, 897
SseBI	AGGCCT	1 cut(s)	805
SspMI	CTAG	5 cut(s)	105, 489, 612, 882, 1080
StuI	AGGCCT	1 cut(s)	805
StyD4I	CCNGG	2 cut(s)	796, 829
StyI	CCWWGG	1 cut(s)	134
TaaI	ACNGT	2 cut(s)	536, 711
TaqI	TCGA	1 cut(s)	219
TasI	AATT	7 cut(s)	263, 556, 653, 768, 875, 885, 897
TfiI	GAWTC	3 cut(s)	221, 350, 700
Tru1I	TTAA	2 cut(s)	821, 1177
Tru9I	TTAA	2 cut(s)	821, 1177
TscAI	CASTG	2 cut(s)	539, 716
TseI	GCWGC	6 cut(s)	8, 165, 793, 1069, 1089, 1103
TspDTI	ATGAA	3 cut(s)	827, 891, 909
TspRI	CASTG	2 cut(s)	539, 716
Van91I	CCANNNNNTGG	2 cut(s)	427, 938
VneI	GTGCAC	1 cut(s)	1113
VpaK11BI	GGWCC	1 cut(s)	929
XapI	RAATTY	2 cut(s)	263, 897
XbaI	TCTAGA	1 cut(s)	488
XspI	CTAG	5 cut(s)	105, 489, 612, 882, 1080
Zsp2I	ATGCAT	1 cut(s)	1051

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.