Rh2CG442800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0014636
Physical Location & Seq
Forward (+)
59932719 .. 59933170
452 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG442800.1

Sequence Viewer

Length: 312 bp
ATGAAGATGGAGACAGTGATGAAGGGTCATACTTTTATGTTGACTCAAATTATGATCTTAATGCATGCTGATGAGTTTGATGATGTGGAGTTTCAAGAAAATGTCTTTGAACCAAGGGTTGTGCCAGAATTTGATGAGATAGGTTTTAGTGGCTACTACTCAGATGAAGTACATGATTCAGATGAGTTGAATAGCTTAAGTGGAAGTGAGATTGATGAAGATGAAGATGGAAATCCAGTTCCAAAGAAGGGACTTAAGGGAGTGAAGATCAGACCTTGGATCAGATCTGTTGATATCCTAAGTTTAGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.75

Weight (kDa)

4.31

Isoelectric Point (pI)

44.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 287
AcsI RAATTY 1 cut(s) 128
AfaI GTAC 1 cut(s) 171
AfiI CCNNNNNNNGG 1 cut(s) 248
AflII CTTAAG 2 cut(s) 196, 254
AgsI TTSAA 3 cut(s) 95, 110, 190
AloI GAACNNNNNNTCC 2 cut(s) 222, 254
AluBI AGCT 1 cut(s) 195
AluI AGCT 1 cut(s) 195
Alw26I GTCTC 1 cut(s) 5
AlwI GGATC 1 cut(s) 287
ApoI RAATTY 1 cut(s) 128
BccI CCATC 1 cut(s) 221
BcoDI GTCTC 1 cut(s) 5
BfrI CTTAAG 2 cut(s) 196, 254
BglII AGATCT 1 cut(s) 284
BsaBI GATNNNNATC 1 cut(s) 231
BsaJI CCNNGG 2 cut(s) 113, 275
Bsc4I CCNNNNNNNGG 1 cut(s) 248
Bse1I ACTGG 1 cut(s) 236
Bse8I GATNNNNATC 1 cut(s) 231
BseDI CCNNGG 2 cut(s) 113, 275
BseJI GATNNNNATC 1 cut(s) 231
BseLI CCNNNNNNNGG 1 cut(s) 248
BseMII CTCAG 1 cut(s) 174
BseNI ACTGG 1 cut(s) 236
BslFI GGGAC 1 cut(s) 264
BslI CCNNNNNNNGG 1 cut(s) 248
BsmAI GTCTC 1 cut(s) 5
BsmFI GGGAC 1 cut(s) 264
Bsp143I GATC 4 cut(s) 54, 267, 279, 284
BspCNI CTCAG 1 cut(s) 173
BspPI GGATC 1 cut(s) 287
BspTI CTTAAG 2 cut(s) 196, 254
BsrI ACTGG 1 cut(s) 236
BssECI CCNNGG 2 cut(s) 113, 275
BssMI GATC 4 cut(s) 54, 267, 279, 284
BssT1I CCWWGG 2 cut(s) 113, 275
Bst4CI ACNGT 1 cut(s) 16
BstAFI CTTAAG 2 cut(s) 196, 254
BstC8I GCNNGC 1 cut(s) 66
BstDEI CTNAG 2 cut(s) 160, 299
BstKTI GATC 4 cut(s) 57, 270, 282, 287
BstMAI GTCTC 1 cut(s) 5
BstMBI GATC 4 cut(s) 54, 267, 279, 284
BstNSI RCATGY 1 cut(s) 68
BstX2I RGATCY 1 cut(s) 284
BstYI RGATCY 1 cut(s) 284
BtsIMutI CAGTG 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 66
Csp6I GTAC 1 cut(s) 170
CviAII CATG 2 cut(s) 65, 173
CviJI RGCY 2 cut(s) 153, 195
CviKI_1 RGCY 2 cut(s) 153, 195
CviQI GTAC 1 cut(s) 170
DdeI CTNAG 2 cut(s) 160, 299
DpnI GATC 4 cut(s) 56, 269, 281, 286
DpnII GATC 4 cut(s) 54, 267, 279, 284
Eco130I CCWWGG 2 cut(s) 113, 275
Eco32I GATATC 1 cut(s) 295
EcoRV GATATC 1 cut(s) 295
EcoT14I CCWWGG 2 cut(s) 113, 275
EcoT22I ATGCAT 1 cut(s) 66
ErhI CCWWGG 2 cut(s) 113, 275
FaeI CATG 2 cut(s) 68, 176
FaiI YATR 5 cut(s) 30, 38, 53, 66, 174
FaqI GGGAC 1 cut(s) 264
FatI CATG 2 cut(s) 64, 172
Hin1II CATG 2 cut(s) 68, 176
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HinfI GANTC 2 cut(s) 43, 176
Hpy166II GTNNAC 1 cut(s) 42
Hpy188I TCNGA 4 cut(s) 163, 181, 272, 284
Hpy188III TCNNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 2 cut(s) 16, 241
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 64
HpyF3I CTNAG 2 cut(s) 160, 299
Hsp92II CATG 2 cut(s) 68, 176
Kzo9I GATC 4 cut(s) 54, 267, 279, 284
LpnPI CCDG 2 cut(s) 138, 249
MalI GATC 4 cut(s) 56, 269, 281, 286
MboI GATC 4 cut(s) 54, 267, 279, 284
MboII GAAGA 4 cut(s) 16, 230, 236, 277
MflI RGATCY 1 cut(s) 284
MluCI AATT 2 cut(s) 48, 128
MlyI GAGTC 1 cut(s) 37
Mph1103I ATGCAT 1 cut(s) 66
MseI TTAA 3 cut(s) 59, 197, 255
MslI CAYNNNNRTG 1 cut(s) 69
MspCI CTTAAG 2 cut(s) 196, 254
NdeII GATC 4 cut(s) 54, 267, 279, 284
NlaIII CATG 2 cut(s) 68, 176
NsiI ATGCAT 1 cut(s) 66
NspI RCATGY 1 cut(s) 68
PaeI GCATGC 1 cut(s) 68
PfeI GAWTC 1 cut(s) 176
PleI GAGTC 1 cut(s) 37
PpsI GAGTC 1 cut(s) 37
PsuI RGATCY 1 cut(s) 284
RsaI GTAC 1 cut(s) 171
RsaNI GTAC 1 cut(s) 170
RseI CAYNNNNRTG 1 cut(s) 69
SaqAI TTAA 3 cut(s) 59, 197, 255
Sau3AI GATC 4 cut(s) 54, 267, 279, 284
SchI GAGTC 1 cut(s) 37
SetI ASST 4 cut(s) 145, 197, 277, 310
SgeI CNNG 7 cut(s) 77, 107, 126, 137, 185, 248, 288
SmiMI CAYNNNNRTG 1 cut(s) 69
SmlI CTYRAG 2 cut(s) 196, 254
SmoI CTYRAG 2 cut(s) 196, 254
SphI GCATGC 1 cut(s) 68
Sse9I AATT 2 cut(s) 48, 128
StyI CCWWGG 2 cut(s) 113, 275
TaaI ACNGT 1 cut(s) 16
TasI AATT 2 cut(s) 48, 128
TatI WGTACW 1 cut(s) 169
TfiI GAWTC 1 cut(s) 176
Tru1I TTAA 3 cut(s) 59, 197, 255
Tru9I TTAA 3 cut(s) 59, 197, 255
TscAI CASTG 1 cut(s) 21
TspDTI ATGAA 5 cut(s) 17, 35, 180, 231, 237
TspRI CASTG 1 cut(s) 21
Vha464I CTTAAG 2 cut(s) 196, 254
XapI RAATTY 1 cut(s) 128
XceI RCATGY 1 cut(s) 68
Zsp2I ATGCAT 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.