Rh2CG414600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0014636
Physical Location & Seq
Reverse (-)
56639751 .. 56640108
358 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG414600.1

Sequence Viewer

Length: 243 bp
ATGGGAGGGCATCCTGAAGTGATAAAGTTGGACTCAGATAGTGATAAAGAAGTAGGGGATGGTGTGCAGCAGCAAAGTCAAGGCACCTTTACCGGTCTTAGTAACCTGGTGCCTAACCTGTTTGCTTCACAAGGTGAGGGAATCCAAAGTGAGGGAATCCAAGGTGAGCTGAGGGAAGGCCTGAAGACAAGGCTGCAGAAAGTACAAAAGAAGGAGGACCAGTTCAAGGGGCTGTGGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.76

Weight (kDa)

5.28

Isoelectric Point (pI)

40.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 83, 109
AcuI CTGAAG 2 cut(s) 36, 203
AdeI CACNNNGTG 1 cut(s) 134
AfaI GTAC 1 cut(s) 204
AfiI CCNNNNNNNGG 2 cut(s) 151, 226
AgeI ACCGGT 1 cut(s) 92
AgsI TTSAA 1 cut(s) 226
AjnI CCWGG 1 cut(s) 105
AloI GAACNNNNNNTCC 2 cut(s) 206, 238
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
AoxI GGCC 1 cut(s) 178
ApeKI GCWGC 3 cut(s) 67, 70, 193
AsiGI ACCGGT 1 cut(s) 92
AspS9I GGNCC 1 cut(s) 217
AsuHPI GGTGA 2 cut(s) 146, 176
AvaII GGWCC 1 cut(s) 217
BanI GGYRCC 2 cut(s) 83, 109
BbsI GAAGAC 1 cut(s) 191
BbvCI CCTCAGC 1 cut(s) 170
BbvI GCAGC 3 cut(s) 79, 82, 180
BccI CCATC 1 cut(s) 53
BciT130I CCWGG 1 cut(s) 107
BfmI CTRYAG 1 cut(s) 194
BisI GCNGC 3 cut(s) 68, 71, 194
BlsI GCNGC 3 cut(s) 69, 72, 195
Bme1390I CCNGG 1 cut(s) 107
Bme18I GGWCC 1 cut(s) 217
BmgT120I GGNCC 1 cut(s) 217
BmiI GGNNCC 2 cut(s) 85, 111
BmrFI CCNGG 1 cut(s) 107
BmsI GCATC 1 cut(s) 19
BpiI GAAGAC 1 cut(s) 191
Bpu10I CCTNAGC 1 cut(s) 170
BsaJI CCNNGG 1 cut(s) 160
BsaWI WCCGGW 1 cut(s) 92
BsaXI ACNNNNNCTCC 2 cut(s) 206, 236
Bsc4I CCNNNNNNNGG 2 cut(s) 151, 226
Bse118I RCCGGY 1 cut(s) 92
Bse1I ACTGG 1 cut(s) 220
BseBI CCWGG 1 cut(s) 107
BseDI CCNNGG 1 cut(s) 160
BseGI GGATG 2 cut(s) 10, 64
BseLI CCNNNNNNNGG 2 cut(s) 151, 226
BseMII CTCAG 2 cut(s) 48, 161
BseNI ACTGG 1 cut(s) 220
BseXI GCAGC 3 cut(s) 79, 82, 180
BsgI GTGCAG 1 cut(s) 86
BshFI GGCC 1 cut(s) 180
BshNI GGYRCC 2 cut(s) 83, 109
BshTI ACCGGT 1 cut(s) 92
BsiSI CCGG 1 cut(s) 93
BslI CCNNNNNNNGG 2 cut(s) 151, 226
BsnI GGCC 1 cut(s) 180
BspANI GGCC 1 cut(s) 180
BspCNI CTCAG 2 cut(s) 47, 162
BspLI GGNNCC 2 cut(s) 85, 111
BspMAI CTGCAG 1 cut(s) 198
BspT107I GGYRCC 2 cut(s) 83, 109
BsrFI RCCGGY 1 cut(s) 92
BsrI ACTGG 1 cut(s) 220
BssAI RCCGGY 1 cut(s) 92
BssECI CCNNGG 1 cut(s) 160
BssT1I CCWWGG 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 107
BstDEI CTNAG 3 cut(s) 34, 98, 170
BstF5I GGATG 2 cut(s) 10, 64
BstNI CCWGG 1 cut(s) 107
BstSCI CCNGG 1 cut(s) 105
BstSFI CTRYAG 1 cut(s) 194
BstV1I GCAGC 3 cut(s) 79, 82, 180
BstV2I GAAGAC 1 cut(s) 191
BsuRI GGCC 1 cut(s) 180
BtsCI GGATG 2 cut(s) 10, 64
Cfr10I RCCGGY 1 cut(s) 92
Cfr13I GGNCC 1 cut(s) 217
CsiI ACCWGGT 1 cut(s) 105
Csp6I GTAC 1 cut(s) 203
CspAI ACCGGT 1 cut(s) 92
CviJI RGCY 4 cut(s) 169, 180, 193, 232
CviKI_1 RGCY 4 cut(s) 169, 180, 193, 232
CviQI GTAC 1 cut(s) 203
DdeI CTNAG 3 cut(s) 34, 98, 170
DraIII CACNNNGTG 1 cut(s) 134
Eco130I CCWWGG 1 cut(s) 160
Eco147I AGGCCT 1 cut(s) 180
Eco47I GGWCC 1 cut(s) 217
Eco57I CTGAAG 2 cut(s) 36, 203
EcoRII CCWGG 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 160
ErhI CCWWGG 1 cut(s) 160
Fnu4HI GCNGC 3 cut(s) 68, 71, 194
FokI GGATG 1 cut(s) 71
Fsp4HI GCNGC 3 cut(s) 68, 71, 194
GluI GCNGC 3 cut(s) 68, 71, 194
HaeIII GGCC 1 cut(s) 180
HapII CCGG 1 cut(s) 93
HinfI GANTC 3 cut(s) 32, 141, 156
HpaII CCGG 1 cut(s) 93
HphI GGTGA 2 cut(s) 146, 176
Hpy188I TCNGA 1 cut(s) 37
Hpy188III TCNNGA 1 cut(s) 14
HpyAV CCTTC 2 cut(s) 170, 205
HpyCH4V TGCA 2 cut(s) 67, 196
HpyF3I CTNAG 3 cut(s) 34, 98, 170
LpnPI CCDG 7 cut(s) 27, 92, 106, 119, 131, 194, 233
Lsp1109I GCAGC 3 cut(s) 79, 82, 180
LweI GCATC 1 cut(s) 19
MabI ACCWGGT 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 101
MboII GAAGA 1 cut(s) 196
MlyI GAGTC 1 cut(s) 26
MmeI TCCRAC 1 cut(s) 9
MnlI CCTC 4 cut(s) 130, 145, 165, 208
MspI CCGG 1 cut(s) 93
MspR9I CCNGG 1 cut(s) 107
MvaI CCWGG 1 cut(s) 107
NlaIV GGNNCC 2 cut(s) 85, 111
PceI AGGCCT 1 cut(s) 180
PfeI GAWTC 2 cut(s) 141, 156
PinAI ACCGGT 1 cut(s) 92
PkrI GCNGC 3 cut(s) 69, 72, 195
PleI GAGTC 1 cut(s) 26
PpsI GAGTC 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 105
PspGI CCWGG 1 cut(s) 105
PspN4I GGNNCC 2 cut(s) 85, 111
PspPI GGNCC 1 cut(s) 217
PstI CTGCAG 1 cut(s) 198
RsaI GTAC 1 cut(s) 204
RsaNI GTAC 1 cut(s) 203
SatI GCNGC 3 cut(s) 68, 71, 194
Sau96I GGNCC 1 cut(s) 217
SchI GAGTC 1 cut(s) 26
ScrFI CCNGG 1 cut(s) 107
SetI ASST 6 cut(s) 89, 108, 120, 136, 166, 171
SexAI ACCWGGT 1 cut(s) 105
SfaNI GCATC 1 cut(s) 19
SfcI CTRYAG 1 cut(s) 194
SinI GGWCC 1 cut(s) 217
SseBI AGGCCT 1 cut(s) 180
StuI AGGCCT 1 cut(s) 180
StyD4I CCNGG 1 cut(s) 105
StyI CCWWGG 1 cut(s) 160
TatI WGTACW 1 cut(s) 202
TfiI GAWTC 2 cut(s) 141, 156
TseI GCWGC 3 cut(s) 67, 70, 193
VpaK11BI GGWCC 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.