Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004755.1

Orthogroup ID

OG0008834

Physical Location & Seq

Genomic Coordinates Forward (+)

106700 .. 108935

Gene Structure 2236 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004755.1_g000025.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 759 bp

atggaggtggtggaagacacgctttacctgcaattgcataagttatcagccataaaatcggaggaagcactgcaccaattgctttccactctctggaaaacaaggaaaaccggtctccgcgacaagtcccacttgcagtctctcctcaatctacgatcactctccgacctcgaccctgttttggcatgccttcgttcgctcatcagaaaatgggtacatgaaaacttgactgccgacgaccttctgaagctctttccacccgatttgcccctcgatttgcagagcattttgctgttgtcccttcaaaagtttgagtctcaatggaaggacgaaatagccagagagcagcccagaaccagtaccagtggatgttatcaggttaagacaacctctttgggtatgtcgcactcattacataatgatcatgttgctcaattaagccgacatgagtttgcgtcagagttcactcccatgtctccttccaacttgggaactctacctcgcctaaagtcaatgacttggaccatggagaactgtaactccggatcagctaacaaagtggccgtcattaatctcaagctgcaagattataccaaatctagtgtagatgaaatcgaggtgaagttccaactgactagggacactcttgaagcaatgttgaggtcattgacctacatcagagaacaactctcaagcgtggttggggctgcttctgggccatcacagaagaagcaaaagcagtcagatcatgtggtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

COMM_domain

Protein Analysis

252

Amino Acids

28.52

Weight (kDa)

7.77

Isoelectric Point (pI)

54.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008834)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g29410 FvH4_1g29410 FvH4_1g29410 FvH4_1g29410 FvH4_1g29410
malus_domestica	MD14G1012800.v1.1
prunus_persica	Prupe.1G058500_v2.0.a1 Prupe.7G025800_v2.0.a1 Prupe.7G025800_v2.0.a1 Prupe.7G025800_v2.0.a1
pyrus_communis	pycom14g01080
rosa_chinensis	RchiOBHm_Chr3g0495501
rosa_laevigata	RLG00000022615
rosa_multiflora	Rmu_sc0004755.1_g000025 Rmu_sc0006163.1_g000015
rosa_roxburghii	Rroxscaffold_6G00390480
rosa_rugosa	Rorug03G0273800 Rorug03G0273900
rosa_samantha	Rh3AG321500 Rh3BG356800 Rh3CG353600 Rh3DG356100
rosa_wichuraiana	Rw3G028100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	36
AccB7I	CCANNNNNTGG	1 cut(s)	93
AccII	CGCG	1 cut(s)	120
AccIII	TCCGGA	1 cut(s)	542
AciI	CCGC	1 cut(s)	118
AclWI	GGATC	1 cut(s)	553
AcoI	YGGCCR	1 cut(s)	561
AcuI	CTGAAG	1 cut(s)	266
AfaI	GTAC	2 cut(s)	216, 361
AfiI	CCNNNNNNNGG	2 cut(s)	93, 181
AgeI	ACCGGT	1 cut(s)	110
AgsI	TTSAA	2 cut(s)	305, 650
AloI	GAACNNNNNNTCC	2 cut(s)	524, 556
AluBI	AGCT	3 cut(s)	250, 551, 580
AluI	AGCT	3 cut(s)	250, 551, 580
Alw26I	GTCTC	4 cut(s)	119, 144, 321, 480
AlwI	GGATC	1 cut(s)	553
Aor13HI	TCCGGA	1 cut(s)	542
AoxI	GGCC	2 cut(s)	561, 716
ApeKI	GCWGC	3 cut(s)	346, 580, 707
ArsI	GACNNNNNNTTYG	4 cut(s)	376, 408, 549, 581
AseI	ATTAAT	1 cut(s)	570
AsiGI	ACCGGT	1 cut(s)	110
AspS9I	GGNCC	2 cut(s)	522, 716
AsuHPI	GGTGA	1 cut(s)	631
AvaII	GGWCC	1 cut(s)	522
BbsI	GAAGAC	1 cut(s)	21
BbvI	GCAGC	3 cut(s)	358, 567, 694
BccI	CCATC	1 cut(s)	727
BceAI	ACGGC	1 cut(s)	548
BclI	TGATCA	1 cut(s)	421
BcoDI	GTCTC	4 cut(s)	119, 144, 321, 480
BfaI	CTAG	2 cut(s)	600, 636
BfuAI	ACCTGC	1 cut(s)	36
BisI	GCNGC	3 cut(s)	347, 581, 708
BlsI	GCNGC	3 cut(s)	348, 582, 709
Bme18I	GGWCC	1 cut(s)	522
BmgT120I	GGNCC	2 cut(s)	522, 716
BpiI	GAAGAC	1 cut(s)	21
BplI	GAGNNNNNCTC	2 cut(s)	672, 704
BpuEI	CTTGAG	2 cut(s)	560, 676
BsaI	GGTCTC	1 cut(s)	119
BsaJI	CCNNGG	1 cut(s)	525
BsaWI	WCCGGW	2 cut(s)	110, 542
BsaXI	ACNNNNNCTCC	2 cut(s)	524, 554
Bsc4I	CCNNNNNNNGG	2 cut(s)	93, 181
Bse118I	RCCGGY	1 cut(s)	110
Bse1I	ACTGG	2 cut(s)	357, 363
Bse3DI	GCAATG	1 cut(s)	660
BseAI	TCCGGA	1 cut(s)	542
BseDI	CCNNGG	1 cut(s)	525
BseGI	GGATG	1 cut(s)	374
BseLI	CCNNNNNNNGG	2 cut(s)	93, 181
BseMI	GCAATG	1 cut(s)	660
BseNI	ACTGG	2 cut(s)	357, 363
BseRI	GAGGAG	1 cut(s)	134
BseXI	GCAGC	3 cut(s)	358, 567, 694
BsgI	GTGCAG	1 cut(s)	56
Bsh1236I	CGCG	1 cut(s)	120
BshFI	GGCC	2 cut(s)	563, 718
BshTI	ACCGGT	1 cut(s)	110
BsiSI	CCGG	2 cut(s)	111, 543
BslFI	GGGAC	3 cut(s)	112, 283, 653
BslI	CCNNNNNNNGG	2 cut(s)	93, 181
BsmAI	GTCTC	4 cut(s)	119, 144, 321, 480
BsmFI	GGGAC	3 cut(s)	112, 283, 653
BsnI	GGCC	2 cut(s)	563, 718
Bso31I	GGTCTC	1 cut(s)	119
Bsp13I	TCCGGA	1 cut(s)	542
Bsp143I	GATC	4 cut(s)	155, 421, 545, 745
Bsp19I	CCATGG	1 cut(s)	525
BspACI	CCGC	1 cut(s)	118
BspANI	GGCC	2 cut(s)	563, 718
BspEI	TCCGGA	1 cut(s)	542
BspFNI	CGCG	1 cut(s)	120
BspMI	ACCTGC	1 cut(s)	36
BspPI	GGATC	1 cut(s)	553
BspTNI	GGTCTC	1 cut(s)	119
BsrDI	GCAATG	1 cut(s)	660
BsrFI	RCCGGY	1 cut(s)	110
BsrI	ACTGG	2 cut(s)	357, 363
BssAI	RCCGGY	1 cut(s)	110
BssECI	CCNNGG	1 cut(s)	525
BssMI	GATC	4 cut(s)	155, 421, 545, 745
BssT1I	CCWWGG	1 cut(s)	525
Bst4CI	ACNGT	1 cut(s)	536
BstAPI	GCANNNNNTGC	1 cut(s)	79
BstC8I	GCNNGC	1 cut(s)	187
BstDSI	CCRYGG	1 cut(s)	525
BstF5I	GGATG	1 cut(s)	374
BstFNI	CGCG	1 cut(s)	120
BstKTI	GATC	4 cut(s)	158, 424, 548, 748
BstMAI	GTCTC	4 cut(s)	119, 144, 321, 480
BstMBI	GATC	4 cut(s)	155, 421, 545, 745
BstMWI	GCNNNNNNNGC	2 cut(s)	28, 79
BstNSI	RCATGY	1 cut(s)	189
BstUI	CGCG	1 cut(s)	120
BstV1I	GCAGC	3 cut(s)	358, 567, 694
BstV2I	GAAGAC	1 cut(s)	21
BsuRI	GGCC	2 cut(s)	563, 718
BtgI	CCRYGG	1 cut(s)	525
BtsCI	GGATG	1 cut(s)	374
BtsI	GCAGTG	1 cut(s)	68
BtsIMutI	CAGTG	2 cut(s)	68, 370
BveI	ACCTGC	1 cut(s)	36
Cac8I	GCNNGC	1 cut(s)	187
Cfr10I	RCCGGY	1 cut(s)	110
Cfr13I	GGNCC	2 cut(s)	522, 716
CseI	GACGC	1 cut(s)	444
Csp6I	GTAC	2 cut(s)	215, 360
CspAI	ACCGGT	1 cut(s)	110
CspCI	CAANNNNNGTGG	2 cut(s)	246, 281
CviAII	CATG	7 cut(s)	186, 218, 425, 446, 472, 526, 749
CviQI	GTAC	2 cut(s)	215, 360
DpnI	GATC	4 cut(s)	157, 423, 547, 747
DpnII	GATC	4 cut(s)	155, 421, 545, 745
EaeI	YGGCCR	1 cut(s)	561
Eco130I	CCWWGG	1 cut(s)	525
Eco31I	GGTCTC	1 cut(s)	119
Eco47I	GGWCC	1 cut(s)	522
Eco57I	CTGAAG	1 cut(s)	266
EcoT14I	CCWWGG	1 cut(s)	525
ErhI	CCWWGG	1 cut(s)	525
FaeI	CATG	7 cut(s)	189, 221, 428, 449, 475, 529, 752
FalI	AAGNNNNNCTT	3 cut(s)	38, 116, 148
FaqI	GGGAC	3 cut(s)	112, 283, 653
FatI	CATG	7 cut(s)	185, 217, 424, 445, 471, 525, 748
FbaI	TGATCA	1 cut(s)	421
Fnu4HI	GCNGC	3 cut(s)	347, 581, 708
FokI	GGATG	1 cut(s)	381
Fsp4HI	GCNGC	3 cut(s)	347, 581, 708
FspBI	CTAG	2 cut(s)	600, 636
GluI	GCNGC	3 cut(s)	347, 581, 708
HaeIII	GGCC	2 cut(s)	563, 718
HapII	CCGG	2 cut(s)	111, 543
HgaI	GACGC	1 cut(s)	444
Hin1II	CATG	7 cut(s)	189, 221, 428, 449, 475, 529, 752
HinfI	GANTC	1 cut(s)	314
HpaII	CCGG	2 cut(s)	111, 543
HphI	GGTGA	1 cut(s)	631
Hpy166II	GTNNAC	1 cut(s)	465
Hpy188I	TCNGA	7 cut(s)	61, 166, 206, 246, 460, 680, 745
Hpy188III	TCNNGA	3 cut(s)	94, 543, 647
Hpy8I	GTNNAC	1 cut(s)	465
Hpy99I	CGWCG	1 cut(s)	239
HpyAV	CCTTC	5 cut(s)	200, 251, 311, 319, 489
HpyCH4III	ACNGT	1 cut(s)	536
HpyCH4V	TGCA	6 cut(s)	31, 37, 73, 136, 280, 583
HpyF10VI	GCNNNNNNNGC	2 cut(s)	28, 79
Hsp92II	CATG	7 cut(s)	189, 221, 428, 449, 475, 529, 752
Kpn2I	TCCGGA	1 cut(s)	542
Ksp22I	TGATCA	1 cut(s)	421
Kzo9I	GATC	4 cut(s)	155, 421, 545, 745
Lsp1109I	GCAGC	3 cut(s)	358, 567, 694
MaeI	CTAG	2 cut(s)	600, 636
MaeIII	GTNAC	1 cut(s)	536
MalI	GATC	4 cut(s)	157, 423, 547, 747
MboI	GATC	4 cut(s)	155, 421, 545, 745
MboII	GAAGA	2 cut(s)	26, 739
MfeI	CAATTG	2 cut(s)	32, 77
MluCI	AATT	3 cut(s)	32, 77, 434
MlyI	GAGTC	1 cut(s)	323
MmeI	TCCRAC	3 cut(s)	189, 507, 652
MnlI	CCTC	8 cut(s)	55, 155, 179, 281, 400, 510, 610, 654
MroI	TCCGGA	1 cut(s)	542
MseI	TTAA	3 cut(s)	381, 437, 570
MslI	CAYNNNNRTG	1 cut(s)	470
MspI	CCGG	2 cut(s)	111, 543
MunI	CAATTG	2 cut(s)	32, 77
MvnI	CGCG	1 cut(s)	120
MwoI	GCNNNNNNNGC	2 cut(s)	28, 79
NcoI	CCATGG	1 cut(s)	525
NdeII	GATC	4 cut(s)	155, 421, 545, 745
NlaIII	CATG	7 cut(s)	189, 221, 428, 449, 475, 529, 752
NspI	RCATGY	1 cut(s)	189
PaeI	GCATGC	1 cut(s)	189
PflMI	CCANNNNNTGG	1 cut(s)	93
PinAI	ACCGGT	1 cut(s)	110
PkrI	GCNGC	3 cut(s)	348, 582, 709
PleI	GAGTC	1 cut(s)	322
PpsI	GAGTC	1 cut(s)	322
PshBI	ATTAAT	1 cut(s)	570
PspPI	GGNCC	2 cut(s)	522, 716
RsaI	GTAC	2 cut(s)	216, 361
RsaNI	GTAC	2 cut(s)	215, 360
RseI	CAYNNNNRTG	1 cut(s)	470
SaqAI	TTAA	3 cut(s)	381, 437, 570
SatI	GCNGC	3 cut(s)	347, 581, 708
Sau3AI	GATC	4 cut(s)	155, 421, 545, 745
Sau96I	GGNCC	2 cut(s)	522, 716
SchI	GAGTC	1 cut(s)	323
SinI	GGWCC	1 cut(s)	522
SmiMI	CAYNNNNRTG	1 cut(s)	470
SmlI	CTYRAG	2 cut(s)	575, 691
SmoI	CTYRAG	2 cut(s)	575, 691
SphI	GCATGC	1 cut(s)	189
Sse9I	AATT	3 cut(s)	32, 77, 434
SsiI	CCGC	1 cut(s)	118
SspMI	CTAG	2 cut(s)	600, 636
StyI	CCWWGG	1 cut(s)	525
TaaI	ACNGT	1 cut(s)	536
TaqI	TCGA	3 cut(s)	171, 273, 615
TasI	AATT	3 cut(s)	32, 77, 434
Tru1I	TTAA	3 cut(s)	381, 437, 570
Tru9I	TTAA	3 cut(s)	381, 437, 570
TscAI	CASTG	2 cut(s)	75, 370
TseI	GCWGC	3 cut(s)	346, 580, 707
TspDTI	ATGAA	2 cut(s)	234, 624
TspRI	CASTG	2 cut(s)	75, 370
Van91I	CCANNNNNTGG	1 cut(s)	93
VpaK11BI	GGWCC	1 cut(s)	522
VspI	ATTAAT	1 cut(s)	570
XceI	RCATGY	1 cut(s)	189
XspI	CTAG	2 cut(s)	600, 636

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.