Rmu_sc0004755.1_g000025

COMM domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004755.1
Physical Location & Seq
Forward (+)
106700 .. 108935
2236 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004755.1_g000025.1.cds

Sequence Viewer

Length: 759 bp
atggaggtggtggaagacacgctttacctgcaattgcataagttatcagccataaaatcggaggaagcactgcaccaattgctttccactctctggaaaacaaggaaaaccggtctccgcgacaagtcccacttgcagtctctcctcaatctacgatcactctccgacctcgaccctgttttggcatgccttcgttcgctcatcagaaaatgggtacatgaaaacttgactgccgacgaccttctgaagctctttccacccgatttgcccctcgatttgcagagcattttgctgttgtcccttcaaaagtttgagtctcaatggaaggacgaaatagccagagagcagcccagaaccagtaccagtggatgttatcaggttaagacaacctctttgggtatgtcgcactcattacataatgatcatgttgctcaattaagccgacatgagtttgcgtcagagttcactcccatgtctccttccaacttgggaactctacctcgcctaaagtcaatgacttggaccatggagaactgtaactccggatcagctaacaaagtggccgtcattaatctcaagctgcaagattataccaaatctagtgtagatgaaatcgaggtgaagttccaactgactagggacactcttgaagcaatgttgaggtcattgacctacatcagagaacaactctcaagcgtggttggggctgcttctgggccatcacagaagaagcaaaagcagtcagatcatgtggtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

252

Amino Acids

28.52

Weight (kDa)

7.77

Isoelectric Point (pI)

54.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 36
AccB7I CCANNNNNTGG 1 cut(s) 93
AccII CGCG 1 cut(s) 120
AccIII TCCGGA 1 cut(s) 542
AciI CCGC 1 cut(s) 118
AclWI GGATC 1 cut(s) 553
AcoI YGGCCR 1 cut(s) 561
AcuI CTGAAG 1 cut(s) 266
AfaI GTAC 2 cut(s) 216, 361
AfiI CCNNNNNNNGG 2 cut(s) 93, 181
AgeI ACCGGT 1 cut(s) 110
AgsI TTSAA 2 cut(s) 305, 650
AloI GAACNNNNNNTCC 2 cut(s) 524, 556
AluBI AGCT 3 cut(s) 250, 551, 580
AluI AGCT 3 cut(s) 250, 551, 580
Alw26I GTCTC 4 cut(s) 119, 144, 321, 480
AlwI GGATC 1 cut(s) 553
Aor13HI TCCGGA 1 cut(s) 542
AoxI GGCC 2 cut(s) 561, 716
ApeKI GCWGC 3 cut(s) 346, 580, 707
ArsI GACNNNNNNTTYG 4 cut(s) 376, 408, 549, 581
AseI ATTAAT 1 cut(s) 570
AsiGI ACCGGT 1 cut(s) 110
AspS9I GGNCC 2 cut(s) 522, 716
AsuHPI GGTGA 1 cut(s) 631
AvaII GGWCC 1 cut(s) 522
BbsI GAAGAC 1 cut(s) 21
BbvI GCAGC 3 cut(s) 358, 567, 694
BccI CCATC 1 cut(s) 727
BceAI ACGGC 1 cut(s) 548
BclI TGATCA 1 cut(s) 421
BcoDI GTCTC 4 cut(s) 119, 144, 321, 480
BfaI CTAG 2 cut(s) 600, 636
BfuAI ACCTGC 1 cut(s) 36
BisI GCNGC 3 cut(s) 347, 581, 708
BlsI GCNGC 3 cut(s) 348, 582, 709
Bme18I GGWCC 1 cut(s) 522
BmgT120I GGNCC 2 cut(s) 522, 716
BpiI GAAGAC 1 cut(s) 21
BplI GAGNNNNNCTC 2 cut(s) 672, 704
BpuEI CTTGAG 2 cut(s) 560, 676
BsaI GGTCTC 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 525
BsaWI WCCGGW 2 cut(s) 110, 542
BsaXI ACNNNNNCTCC 2 cut(s) 524, 554
Bsc4I CCNNNNNNNGG 2 cut(s) 93, 181
Bse118I RCCGGY 1 cut(s) 110
Bse1I ACTGG 2 cut(s) 357, 363
Bse3DI GCAATG 1 cut(s) 660
BseAI TCCGGA 1 cut(s) 542
BseDI CCNNGG 1 cut(s) 525
BseGI GGATG 1 cut(s) 374
BseLI CCNNNNNNNGG 2 cut(s) 93, 181
BseMI GCAATG 1 cut(s) 660
BseNI ACTGG 2 cut(s) 357, 363
BseRI GAGGAG 1 cut(s) 134
BseXI GCAGC 3 cut(s) 358, 567, 694
BsgI GTGCAG 1 cut(s) 56
Bsh1236I CGCG 1 cut(s) 120
BshFI GGCC 2 cut(s) 563, 718
BshTI ACCGGT 1 cut(s) 110
BsiSI CCGG 2 cut(s) 111, 543
BslFI GGGAC 3 cut(s) 112, 283, 653
BslI CCNNNNNNNGG 2 cut(s) 93, 181
BsmAI GTCTC 4 cut(s) 119, 144, 321, 480
BsmFI GGGAC 3 cut(s) 112, 283, 653
BsnI GGCC 2 cut(s) 563, 718
Bso31I GGTCTC 1 cut(s) 119
Bsp13I TCCGGA 1 cut(s) 542
Bsp143I GATC 4 cut(s) 155, 421, 545, 745
Bsp19I CCATGG 1 cut(s) 525
BspACI CCGC 1 cut(s) 118
BspANI GGCC 2 cut(s) 563, 718
BspEI TCCGGA 1 cut(s) 542
BspFNI CGCG 1 cut(s) 120
BspMI ACCTGC 1 cut(s) 36
BspPI GGATC 1 cut(s) 553
BspTNI GGTCTC 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 660
BsrFI RCCGGY 1 cut(s) 110
BsrI ACTGG 2 cut(s) 357, 363
BssAI RCCGGY 1 cut(s) 110
BssECI CCNNGG 1 cut(s) 525
BssMI GATC 4 cut(s) 155, 421, 545, 745
BssT1I CCWWGG 1 cut(s) 525
Bst4CI ACNGT 1 cut(s) 536
BstAPI GCANNNNNTGC 1 cut(s) 79
BstC8I GCNNGC 1 cut(s) 187
BstDSI CCRYGG 1 cut(s) 525
BstF5I GGATG 1 cut(s) 374
BstFNI CGCG 1 cut(s) 120
BstKTI GATC 4 cut(s) 158, 424, 548, 748
BstMAI GTCTC 4 cut(s) 119, 144, 321, 480
BstMBI GATC 4 cut(s) 155, 421, 545, 745
BstMWI GCNNNNNNNGC 2 cut(s) 28, 79
BstNSI RCATGY 1 cut(s) 189
BstUI CGCG 1 cut(s) 120
BstV1I GCAGC 3 cut(s) 358, 567, 694
BstV2I GAAGAC 1 cut(s) 21
BsuRI GGCC 2 cut(s) 563, 718
BtgI CCRYGG 1 cut(s) 525
BtsCI GGATG 1 cut(s) 374
BtsI GCAGTG 1 cut(s) 68
BtsIMutI CAGTG 2 cut(s) 68, 370
BveI ACCTGC 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 187
Cfr10I RCCGGY 1 cut(s) 110
Cfr13I GGNCC 2 cut(s) 522, 716
CseI GACGC 1 cut(s) 444
Csp6I GTAC 2 cut(s) 215, 360
CspAI ACCGGT 1 cut(s) 110
CspCI CAANNNNNGTGG 2 cut(s) 246, 281
CviAII CATG 7 cut(s) 186, 218, 425, 446, 472, 526, 749
CviQI GTAC 2 cut(s) 215, 360
DpnI GATC 4 cut(s) 157, 423, 547, 747
DpnII GATC 4 cut(s) 155, 421, 545, 745
EaeI YGGCCR 1 cut(s) 561
Eco130I CCWWGG 1 cut(s) 525
Eco31I GGTCTC 1 cut(s) 119
Eco47I GGWCC 1 cut(s) 522
Eco57I CTGAAG 1 cut(s) 266
EcoT14I CCWWGG 1 cut(s) 525
ErhI CCWWGG 1 cut(s) 525
FaeI CATG 7 cut(s) 189, 221, 428, 449, 475, 529, 752
FalI AAGNNNNNCTT 3 cut(s) 38, 116, 148
FaqI GGGAC 3 cut(s) 112, 283, 653
FatI CATG 7 cut(s) 185, 217, 424, 445, 471, 525, 748
FbaI TGATCA 1 cut(s) 421
Fnu4HI GCNGC 3 cut(s) 347, 581, 708
FokI GGATG 1 cut(s) 381
Fsp4HI GCNGC 3 cut(s) 347, 581, 708
FspBI CTAG 2 cut(s) 600, 636
GluI GCNGC 3 cut(s) 347, 581, 708
HaeIII GGCC 2 cut(s) 563, 718
HapII CCGG 2 cut(s) 111, 543
HgaI GACGC 1 cut(s) 444
Hin1II CATG 7 cut(s) 189, 221, 428, 449, 475, 529, 752
HinfI GANTC 1 cut(s) 314
HpaII CCGG 2 cut(s) 111, 543
HphI GGTGA 1 cut(s) 631
Hpy166II GTNNAC 1 cut(s) 465
Hpy188I TCNGA 7 cut(s) 61, 166, 206, 246, 460, 680, 745
Hpy188III TCNNGA 3 cut(s) 94, 543, 647
Hpy8I GTNNAC 1 cut(s) 465
Hpy99I CGWCG 1 cut(s) 239
HpyAV CCTTC 5 cut(s) 200, 251, 311, 319, 489
HpyCH4III ACNGT 1 cut(s) 536
HpyCH4V TGCA 6 cut(s) 31, 37, 73, 136, 280, 583
HpyF10VI GCNNNNNNNGC 2 cut(s) 28, 79
Hsp92II CATG 7 cut(s) 189, 221, 428, 449, 475, 529, 752
Kpn2I TCCGGA 1 cut(s) 542
Ksp22I TGATCA 1 cut(s) 421
Kzo9I GATC 4 cut(s) 155, 421, 545, 745
Lsp1109I GCAGC 3 cut(s) 358, 567, 694
MaeI CTAG 2 cut(s) 600, 636
MaeIII GTNAC 1 cut(s) 536
MalI GATC 4 cut(s) 157, 423, 547, 747
MboI GATC 4 cut(s) 155, 421, 545, 745
MboII GAAGA 2 cut(s) 26, 739
MfeI CAATTG 2 cut(s) 32, 77
MluCI AATT 3 cut(s) 32, 77, 434
MlyI GAGTC 1 cut(s) 323
MmeI TCCRAC 3 cut(s) 189, 507, 652
MnlI CCTC 8 cut(s) 55, 155, 179, 281, 400, 510, 610, 654
MroI TCCGGA 1 cut(s) 542
MseI TTAA 3 cut(s) 381, 437, 570
MslI CAYNNNNRTG 1 cut(s) 470
MspI CCGG 2 cut(s) 111, 543
MunI CAATTG 2 cut(s) 32, 77
MvnI CGCG 1 cut(s) 120
MwoI GCNNNNNNNGC 2 cut(s) 28, 79
NcoI CCATGG 1 cut(s) 525
NdeII GATC 4 cut(s) 155, 421, 545, 745
NlaIII CATG 7 cut(s) 189, 221, 428, 449, 475, 529, 752
NspI RCATGY 1 cut(s) 189
PaeI GCATGC 1 cut(s) 189
PflMI CCANNNNNTGG 1 cut(s) 93
PinAI ACCGGT 1 cut(s) 110
PkrI GCNGC 3 cut(s) 348, 582, 709
PleI GAGTC 1 cut(s) 322
PpsI GAGTC 1 cut(s) 322
PshBI ATTAAT 1 cut(s) 570
PspPI GGNCC 2 cut(s) 522, 716
RsaI GTAC 2 cut(s) 216, 361
RsaNI GTAC 2 cut(s) 215, 360
RseI CAYNNNNRTG 1 cut(s) 470
SaqAI TTAA 3 cut(s) 381, 437, 570
SatI GCNGC 3 cut(s) 347, 581, 708
Sau3AI GATC 4 cut(s) 155, 421, 545, 745
Sau96I GGNCC 2 cut(s) 522, 716
SchI GAGTC 1 cut(s) 323
SinI GGWCC 1 cut(s) 522
SmiMI CAYNNNNRTG 1 cut(s) 470
SmlI CTYRAG 2 cut(s) 575, 691
SmoI CTYRAG 2 cut(s) 575, 691
SphI GCATGC 1 cut(s) 189
Sse9I AATT 3 cut(s) 32, 77, 434
SsiI CCGC 1 cut(s) 118
SspMI CTAG 2 cut(s) 600, 636
StyI CCWWGG 1 cut(s) 525
TaaI ACNGT 1 cut(s) 536
TaqI TCGA 3 cut(s) 171, 273, 615
TasI AATT 3 cut(s) 32, 77, 434
Tru1I TTAA 3 cut(s) 381, 437, 570
Tru9I TTAA 3 cut(s) 381, 437, 570
TscAI CASTG 2 cut(s) 75, 370
TseI GCWGC 3 cut(s) 346, 580, 707
TspDTI ATGAA 2 cut(s) 234, 624
TspRI CASTG 2 cut(s) 75, 370
Van91I CCANNNNNTGG 1 cut(s) 93
VpaK11BI GGWCC 1 cut(s) 522
VspI ATTAAT 1 cut(s) 570
XceI RCATGY 1 cut(s) 189
XspI CTAG 2 cut(s) 600, 636
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.