Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006163.1

Orthogroup ID

OG0008834

Physical Location & Seq

Genomic Coordinates Forward (+)

71884 .. 75657

Gene Structure 3774 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006163.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 939 bp

atggaggtggtggaagacacgctttacctgcaattgcataagttatcagccataaattcggaggaagcactgcaccaattgctttccactctctggaaaacaaggaaaaccggtctccgcgacaagtcccacttgcagtctctcctcaatctacgatcactctccgacctcgaccctgttttggcatgccttcgttcgctcatcagaaaatgggtacatgaaaacttgactgccgacgaccttctgaagctctttccacccgatttgcccctcgatttgcagagcattttgctgttgtcccttcaaaagtttgagtctcaatggaaggacgaaatagccagagagcaggttaagacaacctctttgggtatgtcgcactcattacataatgatcatgttgctcaattaagccgacatgagtttgcgtcagagttcactcccatgtctccctccaacttgggaactctacctcgcctaaagtcaatgacttggaccatggagaactgtaactccggatcagctaacaaagtggccgtcattaatctcaagctgcaagattataccaaatctagtgtagatgaaatcgaggtgaagttccaactgactagggacactcttgaagcaatgttgaggtcattgacctacatcagagaacaactctcaagcgtgggaactctacctcgcctaaagtcaatgacttggaccatggagaactgtaactccggatcagctaacaaagtggccgtcattaatctcaagctgcaagattataccaaatctagtgtagatgaaatcgaggtgaagttccaactgactagggacactcttgaagcaatgttgaggtcattgacctacatcagagaacaactctcaagcgtggttggggctgcttctgggccatcacagaagaagcaaaagcagtcagatcatgtggtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

COMM_domain

Protein Analysis

312

Amino Acids

35.36

Weight (kDa)

7.13

Isoelectric Point (pI)

50.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008834)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g29410 FvH4_1g29410 FvH4_1g29410 FvH4_1g29410 FvH4_1g29410
malus_domestica	MD14G1012800.v1.1
prunus_persica	Prupe.1G058500_v2.0.a1 Prupe.7G025800_v2.0.a1 Prupe.7G025800_v2.0.a1 Prupe.7G025800_v2.0.a1
pyrus_communis	pycom14g01080
rosa_chinensis	RchiOBHm_Chr3g0495501
rosa_laevigata	RLG00000022615
rosa_multiflora	Rmu_sc0004755.1_g000025 Rmu_sc0006163.1_g000015
rosa_roxburghii	Rroxscaffold_6G00390480
rosa_rugosa	Rorug03G0273800 Rorug03G0273900
rosa_samantha	Rh3AG321500 Rh3BG356800 Rh3CG353600 Rh3DG356100
rosa_wichuraiana	Rw3G028100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	36, 337
AccB7I	CCANNNNNTGG	1 cut(s)	93
AccII	CGCG	1 cut(s)	120
AccIII	TCCGGA	2 cut(s)	512, 722
AciI	CCGC	1 cut(s)	118
AclWI	GGATC	2 cut(s)	523, 733
AcoI	YGGCCR	2 cut(s)	531, 741
AcsI	RAATTY	1 cut(s)	55
AcuI	CTGAAG	1 cut(s)	266
AfaI	GTAC	1 cut(s)	216
AfiI	CCNNNNNNNGG	2 cut(s)	93, 181
AgeI	ACCGGT	1 cut(s)	110
AgsI	TTSAA	3 cut(s)	305, 620, 830
AloI	GAACNNNNNNTCC	4 cut(s)	494, 526, 704, 736
AluBI	AGCT	5 cut(s)	250, 521, 550, 731, 760
AluI	AGCT	5 cut(s)	250, 521, 550, 731, 760
Alw26I	GTCTC	4 cut(s)	119, 144, 321, 450
AlwI	GGATC	2 cut(s)	523, 733
Aor13HI	TCCGGA	2 cut(s)	512, 722
AoxI	GGCC	3 cut(s)	531, 741, 896
ApeKI	GCWGC	3 cut(s)	550, 760, 887
ApoI	RAATTY	1 cut(s)	55
ArsI	GACNNNNNNTTYG	6 cut(s)	346, 378, 519, 551, 729, 761
AseI	ATTAAT	2 cut(s)	540, 750
AsiGI	ACCGGT	1 cut(s)	110
AspS9I	GGNCC	3 cut(s)	492, 702, 896
AsuHPI	GGTGA	2 cut(s)	601, 811
AvaII	GGWCC	2 cut(s)	492, 702
BbsI	GAAGAC	1 cut(s)	21
BbvI	GCAGC	3 cut(s)	537, 747, 874
BccI	CCATC	1 cut(s)	907
BceAI	ACGGC	2 cut(s)	518, 728
BclI	TGATCA	1 cut(s)	391
BcoDI	GTCTC	4 cut(s)	119, 144, 321, 450
BfaI	CTAG	4 cut(s)	570, 606, 780, 816
BfuAI	ACCTGC	2 cut(s)	36, 337
BisI	GCNGC	3 cut(s)	551, 761, 888
BlsI	GCNGC	3 cut(s)	552, 762, 889
Bme18I	GGWCC	2 cut(s)	492, 702
BmgT120I	GGNCC	3 cut(s)	492, 702, 896
BpiI	GAAGAC	1 cut(s)	21
BplI	GAGNNNNNCTC	4 cut(s)	642, 674, 852, 884
BpuEI	CTTGAG	4 cut(s)	530, 646, 740, 856
BsaI	GGTCTC	1 cut(s)	119
BsaJI	CCNNGG	2 cut(s)	495, 705
BsaWI	WCCGGW	3 cut(s)	110, 512, 722
BsaXI	ACNNNNNCTCC	4 cut(s)	494, 524, 704, 734
Bsc4I	CCNNNNNNNGG	2 cut(s)	93, 181
Bse118I	RCCGGY	1 cut(s)	110
Bse3DI	GCAATG	2 cut(s)	630, 840
BseAI	TCCGGA	2 cut(s)	512, 722
BseDI	CCNNGG	2 cut(s)	495, 705
BseLI	CCNNNNNNNGG	2 cut(s)	93, 181
BseMI	GCAATG	2 cut(s)	630, 840
BseRI	GAGGAG	1 cut(s)	134
BseXI	GCAGC	3 cut(s)	537, 747, 874
BsgI	GTGCAG	1 cut(s)	56
Bsh1236I	CGCG	1 cut(s)	120
BshFI	GGCC	3 cut(s)	533, 743, 898
BshTI	ACCGGT	1 cut(s)	110
BsiSI	CCGG	3 cut(s)	111, 513, 723
BslFI	GGGAC	4 cut(s)	112, 283, 623, 833
BslI	CCNNNNNNNGG	2 cut(s)	93, 181
BsmAI	GTCTC	4 cut(s)	119, 144, 321, 450
BsmFI	GGGAC	4 cut(s)	112, 283, 623, 833
BsnI	GGCC	3 cut(s)	533, 743, 898
Bso31I	GGTCTC	1 cut(s)	119
Bsp13I	TCCGGA	2 cut(s)	512, 722
Bsp143I	GATC	5 cut(s)	155, 391, 515, 725, 925
Bsp19I	CCATGG	2 cut(s)	495, 705
BspACI	CCGC	1 cut(s)	118
BspANI	GGCC	3 cut(s)	533, 743, 898
BspEI	TCCGGA	2 cut(s)	512, 722
BspFNI	CGCG	1 cut(s)	120
BspMI	ACCTGC	2 cut(s)	36, 337
BspPI	GGATC	2 cut(s)	523, 733
BspTNI	GGTCTC	1 cut(s)	119
BsrDI	GCAATG	2 cut(s)	630, 840
BsrFI	RCCGGY	1 cut(s)	110
BssAI	RCCGGY	1 cut(s)	110
BssECI	CCNNGG	2 cut(s)	495, 705
BssMI	GATC	5 cut(s)	155, 391, 515, 725, 925
BssT1I	CCWWGG	2 cut(s)	495, 705
Bst4CI	ACNGT	2 cut(s)	506, 716
BstAPI	GCANNNNNTGC	1 cut(s)	79
BstC8I	GCNNGC	1 cut(s)	187
BstDSI	CCRYGG	2 cut(s)	495, 705
BstFNI	CGCG	1 cut(s)	120
BstKTI	GATC	5 cut(s)	158, 394, 518, 728, 928
BstMAI	GTCTC	4 cut(s)	119, 144, 321, 450
BstMBI	GATC	5 cut(s)	155, 391, 515, 725, 925
BstMWI	GCNNNNNNNGC	2 cut(s)	28, 79
BstNSI	RCATGY	1 cut(s)	189
BstUI	CGCG	1 cut(s)	120
BstV1I	GCAGC	3 cut(s)	537, 747, 874
BstV2I	GAAGAC	1 cut(s)	21
BsuRI	GGCC	3 cut(s)	533, 743, 898
BtgI	CCRYGG	2 cut(s)	495, 705
BtsI	GCAGTG	1 cut(s)	68
BtsIMutI	CAGTG	1 cut(s)	68
BveI	ACCTGC	2 cut(s)	36, 337
Cac8I	GCNNGC	1 cut(s)	187
Cfr10I	RCCGGY	1 cut(s)	110
Cfr13I	GGNCC	3 cut(s)	492, 702, 896
CseI	GACGC	1 cut(s)	414
Csp6I	GTAC	1 cut(s)	215
CspAI	ACCGGT	1 cut(s)	110
CspCI	CAANNNNNGTGG	2 cut(s)	246, 281
CviAII	CATG	8 cut(s)	186, 218, 395, 416, 442, 496, 706, 929
CviQI	GTAC	1 cut(s)	215
DpnI	GATC	5 cut(s)	157, 393, 517, 727, 927
DpnII	GATC	5 cut(s)	155, 391, 515, 725, 925
EaeI	YGGCCR	2 cut(s)	531, 741
Eco130I	CCWWGG	2 cut(s)	495, 705
Eco31I	GGTCTC	1 cut(s)	119
Eco47I	GGWCC	2 cut(s)	492, 702
Eco57I	CTGAAG	1 cut(s)	266
EcoT14I	CCWWGG	2 cut(s)	495, 705
ErhI	CCWWGG	2 cut(s)	495, 705
FaeI	CATG	8 cut(s)	189, 221, 398, 419, 445, 499, 709, 932
FalI	AAGNNNNNCTT	3 cut(s)	38, 116, 148
FaqI	GGGAC	4 cut(s)	112, 283, 623, 833
FatI	CATG	8 cut(s)	185, 217, 394, 415, 441, 495, 705, 928
FbaI	TGATCA	1 cut(s)	391
Fnu4HI	GCNGC	3 cut(s)	551, 761, 888
Fsp4HI	GCNGC	3 cut(s)	551, 761, 888
FspBI	CTAG	4 cut(s)	570, 606, 780, 816
GluI	GCNGC	3 cut(s)	551, 761, 888
HaeIII	GGCC	3 cut(s)	533, 743, 898
HapII	CCGG	3 cut(s)	111, 513, 723
HgaI	GACGC	1 cut(s)	414
Hin1II	CATG	8 cut(s)	189, 221, 398, 419, 445, 499, 709, 932
HinfI	GANTC	1 cut(s)	314
HpaII	CCGG	3 cut(s)	111, 513, 723
HphI	GGTGA	2 cut(s)	601, 811
Hpy166II	GTNNAC	1 cut(s)	435
Hpy188I	TCNGA	8 cut(s)	61, 166, 206, 246, 430, 650, 860, 925
Hpy188III	TCNNGA	5 cut(s)	94, 513, 617, 723, 827
Hpy8I	GTNNAC	1 cut(s)	435
Hpy99I	CGWCG	1 cut(s)	239
HpyAV	CCTTC	4 cut(s)	200, 251, 311, 319
HpyCH4III	ACNGT	2 cut(s)	506, 716
HpyCH4V	TGCA	7 cut(s)	31, 37, 73, 136, 280, 553, 763
HpyF10VI	GCNNNNNNNGC	2 cut(s)	28, 79
Hsp92II	CATG	8 cut(s)	189, 221, 398, 419, 445, 499, 709, 932
Kpn2I	TCCGGA	2 cut(s)	512, 722
Ksp22I	TGATCA	1 cut(s)	391
Kzo9I	GATC	5 cut(s)	155, 391, 515, 725, 925
LpnPI	CCDG	9 cut(s)	41, 79, 124, 189, 332, 352, 526, 736, 879
Lsp1109I	GCAGC	3 cut(s)	537, 747, 874
MaeI	CTAG	4 cut(s)	570, 606, 780, 816
MaeIII	GTNAC	2 cut(s)	506, 716
MalI	GATC	5 cut(s)	157, 393, 517, 727, 927
MboI	GATC	5 cut(s)	155, 391, 515, 725, 925
MboII	GAAGA	2 cut(s)	26, 919
MfeI	CAATTG	2 cut(s)	32, 77
MluCI	AATT	4 cut(s)	32, 55, 77, 404
MlyI	GAGTC	1 cut(s)	323
MmeI	TCCRAC	4 cut(s)	189, 477, 622, 832
MroI	TCCGGA	2 cut(s)	512, 722
MseI	TTAA	4 cut(s)	351, 407, 540, 750
MslI	CAYNNNNRTG	1 cut(s)	440
MspI	CCGG	3 cut(s)	111, 513, 723
MunI	CAATTG	2 cut(s)	32, 77
MvnI	CGCG	1 cut(s)	120
MwoI	GCNNNNNNNGC	2 cut(s)	28, 79
NcoI	CCATGG	2 cut(s)	495, 705
NdeII	GATC	5 cut(s)	155, 391, 515, 725, 925
NlaIII	CATG	8 cut(s)	189, 221, 398, 419, 445, 499, 709, 932
NspI	RCATGY	1 cut(s)	189
PaeI	GCATGC	1 cut(s)	189
PflMI	CCANNNNNTGG	1 cut(s)	93
PinAI	ACCGGT	1 cut(s)	110
PkrI	GCNGC	3 cut(s)	552, 762, 889
PleI	GAGTC	1 cut(s)	322
PpsI	GAGTC	1 cut(s)	322
PshBI	ATTAAT	2 cut(s)	540, 750
PspPI	GGNCC	3 cut(s)	492, 702, 896
RsaI	GTAC	1 cut(s)	216
RsaNI	GTAC	1 cut(s)	215
RseI	CAYNNNNRTG	1 cut(s)	440
SaqAI	TTAA	4 cut(s)	351, 407, 540, 750
SatI	GCNGC	3 cut(s)	551, 761, 888
Sau3AI	GATC	5 cut(s)	155, 391, 515, 725, 925
Sau96I	GGNCC	3 cut(s)	492, 702, 896
SchI	GAGTC	1 cut(s)	323
SinI	GGWCC	2 cut(s)	492, 702
SmiMI	CAYNNNNRTG	1 cut(s)	440
SmlI	CTYRAG	4 cut(s)	545, 661, 755, 871
SmoI	CTYRAG	4 cut(s)	545, 661, 755, 871
SphI	GCATGC	1 cut(s)	189
Sse9I	AATT	4 cut(s)	32, 55, 77, 404
SsiI	CCGC	1 cut(s)	118
SspMI	CTAG	4 cut(s)	570, 606, 780, 816
StyI	CCWWGG	2 cut(s)	495, 705
TaaI	ACNGT	2 cut(s)	506, 716
TaqI	TCGA	4 cut(s)	171, 273, 585, 795
TasI	AATT	4 cut(s)	32, 55, 77, 404
Tru1I	TTAA	4 cut(s)	351, 407, 540, 750
Tru9I	TTAA	4 cut(s)	351, 407, 540, 750
TscAI	CASTG	1 cut(s)	75
TseI	GCWGC	3 cut(s)	550, 760, 887
TspDTI	ATGAA	3 cut(s)	234, 594, 804
TspRI	CASTG	1 cut(s)	75
Van91I	CCANNNNNTGG	1 cut(s)	93
VpaK11BI	GGWCC	2 cut(s)	492, 702
VspI	ATTAAT	2 cut(s)	540, 750
XapI	RAATTY	1 cut(s)	55
XceI	RCATGY	1 cut(s)	189
XspI	CTAG	4 cut(s)	570, 606, 780, 816

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.