Rmu_sc0005344.1_g000005

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005344.1
OG0015768
Physical Location & Seq
Forward (+)
10538 .. 12257
1720 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005344.1_g000005.1.cds

Sequence Viewer

Length: 879 bp
atgttaatggtgacatgtcggtttctcattggctcggaatcgcggcgctgtgggacccctttcggggatagaagccctgcaagtagatcgctggtatatggtggggactggggagactacttggtcccaaattcccaagtttcaaaggcacaatatttatcatttgctaaatcaggcctgactattcaggatgtgggaggtcgatccgtcttccaatttaaacgtgaagtagagcaaaataacaagatcttgcatgatggtggttcgtggttctatcggaacaccatgctcgttcttggagagtttgatcgtatggggccaatgtcggaggtccctctgaatctcttggagacgtggtttgccatcaaaggtctgcctttgattctacgcaacaagacggccctacatctagtagatgatgcggtgctgcagtccaagagtttggatgctcctacttccccggtccaagcttttgcagatttaaatttggctaaatttttgaaaaattgggcggtgccaatcataccaaaacaggttagtgatgtcaatcctggtgttgatatgtcattaatggttgttccattgtcgagagtggtgggtagtggtgatcaaatgatggtgggaacgtctaatgtgcgcccttctatcctagggctcaaaagaaaaatggtggcagatcttgtcctttataaggaattgctgttaaagaaaccaaagaaatggaaatcccatgaagaactagggcaaggtaattctcattctgagccagcgctggtggaaaatggaggtgcagctggggctatgcaaatggagaagcatcctattacgatagctggtatggagggtgcatttgtatcctcatctaatagtggttgttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

292

Amino Acids

31.9

Weight (kDa)

9.05

Isoelectric Point (pI)

41.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 690
AasI GACNNNNNNGTC 1 cut(s) 122
AccB1I GGYRCC 1 cut(s) 514
AccII CGCG 1 cut(s) 43
AciI CCGC 3 cut(s) 43, 422, 512
AclWI GGATC 1 cut(s) 198
AcsI RAATTY 3 cut(s) 130, 484, 494
AfeI AGCGCT 1 cut(s) 771
AfiI CCNNNNNNNGG 3 cut(s) 63, 64, 691
AflIII ACRYGT 1 cut(s) 14
AgsI TTSAA 2 cut(s) 144, 502
AjiI CACGTC 1 cut(s) 354
AjnI CCWGG 1 cut(s) 550
AluBI AGCT 3 cut(s) 470, 794, 833
AluI AGCT 3 cut(s) 470, 794, 833
Alw26I GTCTC 2 cut(s) 108, 344
AlwI GGATC 1 cut(s) 198
Aor51HI AGCGCT 1 cut(s) 771
AoxI GGCC 3 cut(s) 175, 317, 399
ApeKI GCWGC 2 cut(s) 427, 791
ApoI RAATTY 3 cut(s) 130, 484, 494
AseI ATTAAT 1 cut(s) 569
AspA2I CCTAGG 1 cut(s) 649
AspLEI GCGC 3 cut(s) 48, 639, 772
AspS9I GGNCC 6 cut(s) 54, 124, 317, 331, 400, 463
AsuC2I CCSGG 1 cut(s) 461
AsuHPI GGTGA 2 cut(s) 22, 617
AvaII GGWCC 4 cut(s) 54, 124, 331, 463
AvrII CCTAGG 1 cut(s) 649
BanI GGYRCC 1 cut(s) 514
BanII GRGCYC 1 cut(s) 657
BbsI GAAGAC 1 cut(s) 202
BbvI GCAGC 2 cut(s) 414, 803
BccI CCATC 3 cut(s) 251, 371, 610
BceAI ACGGC 1 cut(s) 414
BcgI CGANNNNNNTGC 2 cut(s) 69, 103
BciT130I CCWGG 1 cut(s) 552
BciVI GTATCC 1 cut(s) 865
BclI TGATCA 1 cut(s) 607
BcnI CCSGG 1 cut(s) 461
BcoDI GTCTC 2 cut(s) 108, 344
BfaI CTAG 3 cut(s) 410, 650, 740
BfmI CTRYAG 1 cut(s) 428
BfoI RGCGCY 2 cut(s) 49, 773
BfuI GTATCC 1 cut(s) 865
BglII AGATCT 2 cut(s) 246, 676
BisI GCNGC 3 cut(s) 44, 428, 792
BlnI CCTAGG 1 cut(s) 649
BlsI GCNGC 3 cut(s) 45, 429, 793
Bme1390I CCNGG 2 cut(s) 461, 552
Bme18I GGWCC 4 cut(s) 54, 124, 331, 463
BmgBI CACGTC 1 cut(s) 354
BmgT120I GGNCC 6 cut(s) 54, 124, 317, 331, 400, 463
BmiI GGNNCC 6 cut(s) 55, 56, 126, 318, 333, 516
BmrFI CCNGG 2 cut(s) 461, 552
BmrI ACTGGG 1 cut(s) 118
BmsI GCATC 3 cut(s) 409, 436, 826
BmuI ACTGGG 1 cut(s) 118
BpiI GAAGAC 1 cut(s) 202
BpuMI CCSGG 1 cut(s) 461
BsaBI GATNNNNATC 1 cut(s) 546
BsaJI CCNNGG 2 cut(s) 459, 649
BsaXI ACNNNNNCTCC 2 cut(s) 341, 371
Bsc4I CCNNNNNNNGG 3 cut(s) 63, 64, 691
Bse1I ACTGG 1 cut(s) 113
Bse8I GATNNNNATC 1 cut(s) 546
BseBI CCWGG 1 cut(s) 552
BseDI CCNNGG 2 cut(s) 459, 649
BseGI GGATG 3 cut(s) 196, 451, 817
BseJI GATNNNNATC 1 cut(s) 546
BseLI CCNNNNNNNGG 3 cut(s) 63, 64, 691
BseMII CTCAG 1 cut(s) 753
BseNI ACTGG 1 cut(s) 113
BseXI GCAGC 2 cut(s) 414, 803
BseYI CCCAGC 1 cut(s) 794
BsgI GTGCAG 1 cut(s) 810
Bsh1236I CGCG 1 cut(s) 43
BshFI GGCC 3 cut(s) 177, 319, 401
BshNI GGYRCC 1 cut(s) 514
BsiSI CCGG 1 cut(s) 461
BslFI GGGAC 4 cut(s) 67, 110, 119, 317
BslI CCNNNNNNNGG 3 cut(s) 63, 64, 691
BsmAI GTCTC 2 cut(s) 108, 344
BsmBI CGTCTC 1 cut(s) 344
BsmFI GGGAC 4 cut(s) 67, 110, 119, 317
BsnI GGCC 3 cut(s) 177, 319, 401
Bsp1286I GDGCHC 1 cut(s) 657
Bsp143I GATC 6 cut(s) 86, 203, 246, 307, 607, 676
BspACI CCGC 3 cut(s) 43, 422, 512
BspANI GGCC 3 cut(s) 177, 319, 401
BspCNI CTCAG 1 cut(s) 754
BspFNI CGCG 1 cut(s) 43
BspLI GGNNCC 6 cut(s) 55, 56, 126, 318, 333, 516
BspMAI CTGCAG 1 cut(s) 432
BspPI GGATC 1 cut(s) 198
BspT107I GGYRCC 1 cut(s) 514
BsrI ACTGG 1 cut(s) 113
BssECI CCNNGG 2 cut(s) 459, 649
BssMI GATC 6 cut(s) 86, 203, 246, 307, 607, 676
BssT1I CCWWGG 1 cut(s) 649
Bst2UI CCWGG 1 cut(s) 552
BstC8I GCNNGC 1 cut(s) 768
BstDEI CTNAG 1 cut(s) 762
BstENI CCTNNNNNAGG 1 cut(s) 689
BstF5I GGATG 3 cut(s) 196, 451, 817
BstFNI CGCG 1 cut(s) 43
BstH2I RGCGCY 2 cut(s) 49, 773
BstHHI GCGC 3 cut(s) 48, 639, 772
BstKTI GATC 6 cut(s) 89, 206, 249, 310, 610, 679
BstMAI GTCTC 2 cut(s) 108, 344
BstMBI GATC 6 cut(s) 86, 203, 246, 307, 607, 676
BstMWI GCNNNNNNNGC 1 cut(s) 797
BstNI CCWGG 1 cut(s) 552
BstNSI RCATGY 1 cut(s) 18
BstSCI CCNGG 2 cut(s) 459, 550
BstSFI CTRYAG 1 cut(s) 428
BstUI CGCG 1 cut(s) 43
BstV1I GCAGC 2 cut(s) 414, 803
BstV2I GAAGAC 1 cut(s) 202
BstX2I RGATCY 2 cut(s) 246, 676
BstXI CCANNNNNNTGG 2 cut(s) 442, 720
BstYI RGATCY 2 cut(s) 246, 676
BsuI GTATCC 1 cut(s) 865
BsuRI GGCC 3 cut(s) 177, 319, 401
BtrI CACGTC 1 cut(s) 354
BtsCI GGATG 3 cut(s) 196, 451, 817
Cac8I GCNNGC 1 cut(s) 768
CfoI GCGC 3 cut(s) 48, 639, 772
Cfr13I GGNCC 6 cut(s) 54, 124, 317, 331, 400, 463
CviAII CATG 4 cut(s) 15, 254, 286, 731
DdeI CTNAG 1 cut(s) 762
DpnI GATC 6 cut(s) 88, 205, 248, 309, 609, 678
DpnII GATC 6 cut(s) 86, 203, 246, 307, 607, 676
DraI TTTAAA 2 cut(s) 220, 483
DrdI GACNNNNNNGTC 1 cut(s) 122
DseDI GACNNNNNNGTC 1 cut(s) 122
Eco130I CCWWGG 1 cut(s) 649
Eco147I AGGCCT 1 cut(s) 177
Eco24I GRGCYC 1 cut(s) 657
Eco47I GGWCC 4 cut(s) 54, 124, 331, 463
Eco47III AGCGCT 1 cut(s) 771
EcoNI CCTNNNNNAGG 1 cut(s) 689
EcoO109I RGGNCCY 2 cut(s) 54, 331
EcoRII CCWGG 1 cut(s) 550
EcoT14I CCWWGG 1 cut(s) 649
EcoT38I GRGCYC 1 cut(s) 657
ErhI CCWWGG 1 cut(s) 649
Esp3I CGTCTC 1 cut(s) 344
FaeI CATG 4 cut(s) 18, 257, 289, 734
FaqI GGGAC 4 cut(s) 67, 110, 119, 317
FatI CATG 4 cut(s) 14, 253, 285, 730
FbaI TGATCA 1 cut(s) 607
Fnu4HI GCNGC 3 cut(s) 44, 428, 792
FokI GGATG 3 cut(s) 203, 458, 804
FriOI GRGCYC 1 cut(s) 657
Fsp4HI GCNGC 3 cut(s) 44, 428, 792
FspBI CTAG 3 cut(s) 410, 650, 740
GlaI GCGC 3 cut(s) 47, 638, 771
GluI GCNGC 3 cut(s) 44, 428, 792
GsaI CCCAGC 1 cut(s) 798
HaeII RGCGCY 2 cut(s) 49, 773
HaeIII GGCC 3 cut(s) 177, 319, 401
HapII CCGG 1 cut(s) 461
HhaI GCGC 3 cut(s) 48, 639, 772
Hin1II CATG 4 cut(s) 18, 257, 289, 734
Hin6I GCGC 3 cut(s) 46, 637, 770
HinP1I GCGC 3 cut(s) 46, 637, 770
HindIII AAGCTT 1 cut(s) 468
HinfI GANTC 3 cut(s) 38, 340, 382
HpaII CCGG 1 cut(s) 461
HphI GGTGA 2 cut(s) 22, 617
Hpy188I TCNGA 5 cut(s) 37, 279, 328, 339, 763
Hpy188III TCNNGA 2 cut(s) 188, 588
HpyAV CCTTC 1 cut(s) 651
HpyCH4IV ACGT 3 cut(s) 223, 353, 626
HpyCH4V TGCA 7 cut(s) 80, 253, 430, 476, 791, 805, 848
HpyF10VI GCNNNNNNNGC 1 cut(s) 797
HpyF3I CTNAG 1 cut(s) 762
HpySE526I ACGT 3 cut(s) 223, 353, 626
Hsp92II CATG 4 cut(s) 18, 257, 289, 734
HspAI GCGC 3 cut(s) 46, 637, 770
KflI GGGWCCC 1 cut(s) 54
Ksp22I TGATCA 1 cut(s) 607
Kzo9I GATC 6 cut(s) 86, 203, 246, 307, 607, 676
LmnI GCTCC 1 cut(s) 454
Lsp1109I GCAGC 2 cut(s) 414, 803
LweI GCATC 3 cut(s) 409, 436, 826
MaeI CTAG 3 cut(s) 410, 650, 740
MaeII ACGT 3 cut(s) 223, 353, 626
MaeIII GTNAC 1 cut(s) 10
MalI GATC 6 cut(s) 88, 205, 248, 309, 609, 678
MboI GATC 6 cut(s) 86, 203, 246, 307, 607, 676
MboII GAAGA 2 cut(s) 202, 746
MflI RGATCY 2 cut(s) 246, 676
MhlI GDGCHC 1 cut(s) 657
MluCI AATT 7 cut(s) 130, 215, 484, 494, 505, 695, 751
MmeI TCCRAC 1 cut(s) 306
MnlI CCTC 6 cut(s) 191, 322, 345, 779, 835, 868
MseI TTAA 5 cut(s) 5, 219, 482, 569, 704
MslI CAYNNNNRTG 1 cut(s) 258
MspA1I CMGCKG 1 cut(s) 794
MspI CCGG 1 cut(s) 461
MspR9I CCNGG 2 cut(s) 461, 552
MvaI CCWGG 1 cut(s) 552
MvnI CGCG 1 cut(s) 43
MwoI GCNNNNNNNGC 1 cut(s) 797
NciI CCSGG 1 cut(s) 461
NdeII GATC 6 cut(s) 86, 203, 246, 307, 607, 676
NlaIII CATG 4 cut(s) 18, 257, 289, 734
NlaIV GGNNCC 6 cut(s) 55, 56, 126, 318, 333, 516
NmuCI GTSAC 1 cut(s) 10
NspI RCATGY 1 cut(s) 18
PceI AGGCCT 1 cut(s) 177
PciI ACATGT 1 cut(s) 14
PfeI GAWTC 3 cut(s) 38, 340, 382
PkrI GCNGC 3 cut(s) 45, 429, 793
PpuMI RGGWCCY 2 cut(s) 54, 331
PscI ACATGT 1 cut(s) 14
PshBI ATTAAT 1 cut(s) 569
PsiI TTATAA 1 cut(s) 690
Psp5II RGGWCCY 2 cut(s) 54, 331
Psp6I CCWGG 1 cut(s) 550
PspFI CCCAGC 1 cut(s) 794
PspGI CCWGG 1 cut(s) 550
PspN4I GGNNCC 6 cut(s) 55, 56, 126, 318, 333, 516
PspPI GGNCC 6 cut(s) 54, 124, 317, 331, 400, 463
PspPPI RGGWCCY 2 cut(s) 54, 331
PstI CTGCAG 1 cut(s) 432
PsuI RGATCY 2 cut(s) 246, 676
PvuII CAGCTG 1 cut(s) 794
RseI CAYNNNNRTG 1 cut(s) 258
SaqAI TTAA 5 cut(s) 5, 219, 482, 569, 704
SatI GCNGC 3 cut(s) 44, 428, 792
Sau3AI GATC 6 cut(s) 86, 203, 246, 307, 607, 676
Sau96I GGNCC 6 cut(s) 54, 124, 317, 331, 400, 463
ScrFI CCNGG 2 cut(s) 461, 552
SduI GDGCHC 1 cut(s) 657
SfaNI GCATC 3 cut(s) 409, 436, 826
SfcI CTRYAG 1 cut(s) 428
SinI GGWCC 4 cut(s) 54, 124, 331, 463
SmiI ATTTAAAT 1 cut(s) 483
SmiMI CAYNNNNRTG 1 cut(s) 258
Sse9I AATT 7 cut(s) 130, 215, 484, 494, 505, 695, 751
SseBI AGGCCT 1 cut(s) 177
SsiI CCGC 3 cut(s) 43, 422, 512
SspI AATATT 1 cut(s) 155
SspMI CTAG 3 cut(s) 410, 650, 740
StuI AGGCCT 1 cut(s) 177
StyD4I CCNGG 2 cut(s) 459, 550
StyI CCWWGG 1 cut(s) 649
SwaI ATTTAAAT 1 cut(s) 483
TaiI ACGT 3 cut(s) 226, 356, 629
TaqI TCGA 2 cut(s) 202, 587
TasI AATT 7 cut(s) 130, 215, 484, 494, 505, 695, 751
TauI GCSGC 1 cut(s) 46
TfiI GAWTC 3 cut(s) 38, 340, 382
Tru1I TTAA 5 cut(s) 5, 219, 482, 569, 704
Tru9I TTAA 5 cut(s) 5, 219, 482, 569, 704
TseFI GTSAC 1 cut(s) 10
TseI GCWGC 2 cut(s) 427, 791
Tsp45I GTSAC 1 cut(s) 10
TspDTI ATGAA 1 cut(s) 747
TspGWI ACGGA 1 cut(s) 196
VpaK11BI GGWCC 4 cut(s) 54, 124, 331, 463
VspI ATTAAT 1 cut(s) 569
XagI CCTNNNNNAGG 1 cut(s) 689
XapI RAATTY 3 cut(s) 130, 484, 494
XceI RCATGY 1 cut(s) 18
XmaJI CCTAGG 1 cut(s) 649
XspI CTAG 3 cut(s) 410, 650, 740
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.