Rmu_sc0005507.1_g000039

transferase activity, transferring hexosyl groups

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005507.1
Physical Location & Seq
Reverse (-)
160898 .. 161641
744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005507.1_g000039.1.cds

Sequence Viewer

Length: 744 bp
atggggctggaaatagacataaatttggctgctgaggaagatgataattataatgaagatgacatggatgatgataattataatgaagatggtatgaatgacgataattataatgaagatggtgtaggagaagaatgtggtcatagtaatggtggtgaaagctccattaatatgaaaaaaaattcaaagccatatgttggaatggactttgattctgatggcattgcacagtcattttatttagagtatgccaagatgacagggtttgctgcttcaaaaatagcttgtcgtcgatcaaaggtaactaaagaatgggtcgaggcaaagtatgcttgtacaagatttgggacaaagcgaaaaaatgacgctcgtaaccctcgtccctacatgaaaatagactgcaaggcaatgttgcatgtcaaaagaaggcaagatgggaaatgggttgttcaaaattttgtgaaagagcataattatgaactttctccggaggatgtccactactttccatgttatagaaacattgcttttggtgacttgaacaatattagtactttgtattcagttggagtgaaaccaagtaagatttttgctgcttcagccaaacagtgtggaggatatcaaaacattggttttttacaaaaagacatgagaaattttttggataagaaacgtcagttagaattggaatctggcgatgctaaggcaatgttggagcattttattagtatgcaagaagattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

247

Amino Acids

28.26

Weight (kDa)

5.11

Isoelectric Point (pI)

54.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 3 cut(s) 51, 81, 111
AccB7I CCANNNNNTGG 1 cut(s) 197
AccIII TCCGGA 1 cut(s) 487
AcsI RAATTY 4 cut(s) 22, 181, 454, 655
AcuI CTGAAG 1 cut(s) 582
AfaI GTAC 2 cut(s) 337, 553
AfiI CCNNNNNNNGG 1 cut(s) 197
AgsI TTSAA 4 cut(s) 186, 276, 452, 541
AluBI AGCT 2 cut(s) 162, 284
AluI AGCT 2 cut(s) 162, 284
Aor13HI TCCGGA 1 cut(s) 487
ApeKI GCWGC 3 cut(s) 29, 269, 593
ApoI RAATTY 4 cut(s) 22, 181, 454, 655
AseI ATTAAT 1 cut(s) 168
AsuHPI GGTGA 2 cut(s) 167, 545
BbvCI CCTCAGC 1 cut(s) 33
BbvI GCAGC 3 cut(s) 16, 256, 580
BccI CCATC 4 cut(s) 83, 113, 212, 428
BisI GCNGC 3 cut(s) 30, 270, 594
BlsI GCNGC 3 cut(s) 31, 271, 595
BmcAI AGTACT 1 cut(s) 553
BmsI GCATC 1 cut(s) 688
Bpu10I CCTNAGC 2 cut(s) 33, 702
BsaWI WCCGGW 1 cut(s) 487
Bsc4I CCNNNNNNNGG 1 cut(s) 197
Bse3DI GCAATG 4 cut(s) 222, 414, 522, 714
BseAI TCCGGA 1 cut(s) 487
BseGI GGATG 2 cut(s) 73, 499
BseLI CCNNNNNNNGG 1 cut(s) 197
BseMI GCAATG 4 cut(s) 222, 414, 522, 714
BseMII CTCAG 1 cut(s) 24
BseXI GCAGC 3 cut(s) 16, 256, 580
BsiSI CCGG 1 cut(s) 488
BslFI GGGAC 2 cut(s) 361, 366
BslI CCNNNNNNNGG 1 cut(s) 197
BsmFI GGGAC 2 cut(s) 361, 366
Bsp13I TCCGGA 1 cut(s) 487
Bsp1407I TGTACA 1 cut(s) 335
Bsp143I GATC 1 cut(s) 293
BspCNI CTCAG 1 cut(s) 25
BspEI TCCGGA 1 cut(s) 487
BsrDI GCAATG 4 cut(s) 222, 414, 522, 714
BsrGI TGTACA 1 cut(s) 335
BssMI GATC 1 cut(s) 293
Bst4CI ACNGT 2 cut(s) 231, 609
BstAPI GCANNNNNTGC 1 cut(s) 329
BstAUI TGTACA 1 cut(s) 335
BstDEI CTNAG 2 cut(s) 33, 702
BstF5I GGATG 2 cut(s) 73, 499
BstKTI GATC 1 cut(s) 296
BstMBI GATC 1 cut(s) 293
BstMWI GCNNNNNNNGC 2 cut(s) 329, 599
BstNSI RCATGY 1 cut(s) 419
BstV1I GCAGC 3 cut(s) 16, 256, 580
BtgZI GCGATG 1 cut(s) 711
BtsCI GGATG 2 cut(s) 73, 499
BtsIMutI CAGTG 1 cut(s) 614
CseI GACGC 1 cut(s) 374
Csp6I GTAC 2 cut(s) 336, 552
CspCI CAANNNNNGTGG 2 cut(s) 592, 627
CviAII CATG 5 cut(s) 64, 388, 416, 510, 649
CviJI RGCY 6 cut(s) 7, 29, 162, 190, 284, 602
CviKI_1 RGCY 6 cut(s) 7, 29, 162, 190, 284, 602
CviQI GTAC 2 cut(s) 336, 552
DdeI CTNAG 2 cut(s) 33, 702
DpnI GATC 1 cut(s) 295
DpnII GATC 1 cut(s) 293
Eco32I GATATC 1 cut(s) 620
Eco57I CTGAAG 1 cut(s) 582
EcoRV GATATC 1 cut(s) 620
FaeI CATG 5 cut(s) 67, 391, 419, 513, 652
FaqI GGGAC 2 cut(s) 361, 366
FatI CATG 5 cut(s) 63, 387, 415, 509, 648
FauNDI CATATG 1 cut(s) 193
Fnu4HI GCNGC 3 cut(s) 30, 270, 594
FokI GGATG 2 cut(s) 80, 506
Fsp4HI GCNGC 3 cut(s) 30, 270, 594
GluI GCNGC 3 cut(s) 30, 270, 594
HapII CCGG 1 cut(s) 488
HgaI GACGC 1 cut(s) 374
Hin1II CATG 5 cut(s) 67, 391, 419, 513, 652
HinfI GANTC 2 cut(s) 212, 689
HpaII CCGG 1 cut(s) 488
HphI GGTGA 2 cut(s) 167, 545
Hpy166II GTNNAC 1 cut(s) 499
Hpy188I TCNGA 1 cut(s) 217
Hpy188III TCNNGA 1 cut(s) 488
Hpy8I GTNNAC 1 cut(s) 499
Hpy99I CGWCG 1 cut(s) 294
HpyAV CCTTC 1 cut(s) 420
HpyCH4III ACNGT 2 cut(s) 231, 609
HpyCH4IV ACGT 1 cut(s) 673
HpyCH4V TGCA 4 cut(s) 227, 402, 415, 733
HpyF10VI GCNNNNNNNGC 2 cut(s) 329, 599
HpyF3I CTNAG 2 cut(s) 33, 702
HpySE526I ACGT 1 cut(s) 673
Hsp92II CATG 5 cut(s) 67, 391, 419, 513, 652
Kpn2I TCCGGA 1 cut(s) 487
Kzo9I GATC 1 cut(s) 293
LmnI GCTCC 2 cut(s) 167, 715
LpnPI CCDG 3 cut(s) 246, 501, 678
Lsp1109I GCAGC 3 cut(s) 16, 256, 580
LweI GCATC 1 cut(s) 688
MaeII ACGT 1 cut(s) 673
MaeIII GTNAC 3 cut(s) 301, 371, 533
MalI GATC 1 cut(s) 295
MboI GATC 1 cut(s) 293
MboII GAAGA 5 cut(s) 50, 68, 98, 128, 143
MluCI AATT 9 cut(s) 22, 46, 76, 106, 181, 454, 472, 655, 683
MmeI TCCRAC 3 cut(s) 178, 547, 693
MnlI CCTC 5 cut(s) 28, 313, 387, 484, 608
MroI TCCGGA 1 cut(s) 487
MseI TTAA 1 cut(s) 168
MslI CAYNNNNRTG 3 cut(s) 147, 170, 474
MspI CCGG 1 cut(s) 488
MwoI GCNNNNNNNGC 2 cut(s) 329, 599
NdeI CATATG 1 cut(s) 193
NdeII GATC 1 cut(s) 293
NlaIII CATG 5 cut(s) 67, 391, 419, 513, 652
NmuCI GTSAC 1 cut(s) 533
NspI RCATGY 1 cut(s) 419
PcsI WCGNNNNNNNCGW 1 cut(s) 376
PfeI GAWTC 2 cut(s) 212, 689
PflMI CCANNNNNTGG 1 cut(s) 197
PkrI GCNGC 3 cut(s) 31, 271, 595
PshBI ATTAAT 1 cut(s) 168
PsiI TTATAA 3 cut(s) 51, 81, 111
RsaI GTAC 2 cut(s) 337, 553
RsaNI GTAC 2 cut(s) 336, 552
RseI CAYNNNNRTG 3 cut(s) 147, 170, 474
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 3 cut(s) 30, 270, 594
Sau3AI GATC 1 cut(s) 293
ScaI AGTACT 1 cut(s) 553
SetI ASST 4 cut(s) 164, 286, 303, 676
SfaNI GCATC 1 cut(s) 688
SmiMI CAYNNNNRTG 3 cut(s) 147, 170, 474
Sse9I AATT 9 cut(s) 22, 46, 76, 106, 181, 454, 472, 655, 683
SspI AATATT 1 cut(s) 547
TaaI ACNGT 2 cut(s) 231, 609
TaiI ACGT 1 cut(s) 676
TaqI TCGA 2 cut(s) 292, 318
TasI AATT 9 cut(s) 22, 46, 76, 106, 181, 454, 472, 655, 683
TatI WGTACW 2 cut(s) 335, 551
TfiI GAWTC 2 cut(s) 212, 689
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TscAI CASTG 1 cut(s) 614
TseFI GTSAC 1 cut(s) 533
TseI GCWGC 3 cut(s) 29, 269, 593
Tsp45I GTSAC 1 cut(s) 533
TspDTI ATGAA 7 cut(s) 69, 99, 110, 129, 188, 404, 492
TspRI CASTG 1 cut(s) 614
Van91I CCANNNNNTGG 1 cut(s) 197
VspI ATTAAT 1 cut(s) 168
XapI RAATTY 4 cut(s) 22, 181, 454, 655
XceI RCATGY 1 cut(s) 419
ZrmI AGTACT 1 cut(s) 553
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.