Rh2CG538900

Protein FAR-RED IMPAIRED RESPONSE

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
71622804 .. 71624438
1635 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG538900.1

Sequence Viewer

Length: 297 bp
ATGGTGAAGAACATTGACAAAGAGAATGTCAATAATAAAGTGAGCTGTGACATTCATATTCTTGATCCAAAAGTTTCAAGCACAAAAGGAGCACCTAAAAGAATACGATCTGGAGTTGAAATCAGTTCAAGAAACGGTAACAAAAGATCAAGAAACGCACAAGAAAATCTGGAAGTACCTAAATATAAGACAAAAAATACCTTACAGAAGGTACATGAAAAAGTAGGGGATACAAATTTTGATAATAATGAATGTACACAAGACTGCTTGCAGGATATTGGGAATACGCTGGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.03

Weight (kDa)

8.82

Isoelectric Point (pI)

70.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AcsI RAATTY 1 cut(s) 235
AfaI GTAC 3 cut(s) 177, 213, 256
AgsI TTSAA 3 cut(s) 78, 119, 129
AluBI AGCT 1 cut(s) 45
AluI AGCT 1 cut(s) 45
Alw21I GWGCWC 1 cut(s) 94
AlwI GGATC 1 cut(s) 59
ApoI RAATTY 1 cut(s) 235
ArsI GACNNNNNNTTYG 2 cut(s) 12, 44
AsuHPI GGTGA 1 cut(s) 16
Bbv12I GWGCWC 1 cut(s) 94
BciVI GTATCC 1 cut(s) 223
BfuI GTATCC 1 cut(s) 223
BpmI CTGGAG 1 cut(s) 132
BsiHKAI GWGCWC 1 cut(s) 94
Bsp1286I GDGCHC 1 cut(s) 94
Bsp1407I TGTACA 1 cut(s) 254
Bsp143I GATC 3 cut(s) 64, 107, 146
BspPI GGATC 1 cut(s) 59
BsrGI TGTACA 1 cut(s) 254
BssMI GATC 3 cut(s) 64, 107, 146
Bst4CI ACNGT 1 cut(s) 137
BstAUI TGTACA 1 cut(s) 254
BstC8I GCNNGC 1 cut(s) 269
BstKTI GATC 3 cut(s) 67, 110, 149
BstMBI GATC 3 cut(s) 64, 107, 146
BsuI GTATCC 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 269
Csp6I GTAC 3 cut(s) 176, 212, 255
CviAII CATG 1 cut(s) 215
CviJI RGCY 1 cut(s) 45
CviKI_1 RGCY 1 cut(s) 45
CviQI GTAC 3 cut(s) 176, 212, 255
DpnI GATC 3 cut(s) 66, 109, 148
DpnII GATC 3 cut(s) 64, 107, 146
FaeI CATG 1 cut(s) 218
FaiI YATR 3 cut(s) 57, 186, 216
FatI CATG 1 cut(s) 214
GsuI CTGGAG 1 cut(s) 132
Hin1II CATG 1 cut(s) 218
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 257
Hpy188III TCNNGA 5 cut(s) 62, 111, 129, 150, 170
Hpy8I GTNNAC 1 cut(s) 257
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 137
HpyCH4V TGCA 1 cut(s) 271
Hsp92II CATG 1 cut(s) 218
Kzo9I GATC 3 cut(s) 64, 107, 146
LmnI GCTCC 1 cut(s) 89
LpnPI CCDG 4 cut(s) 96, 155, 257, 275
MaeIII GTNAC 2 cut(s) 47, 137
MalI GATC 3 cut(s) 66, 109, 148
MboI GATC 3 cut(s) 64, 107, 146
MboII GAAGA 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 94
MluCI AATT 1 cut(s) 235
NdeII GATC 3 cut(s) 64, 107, 146
NlaIII CATG 1 cut(s) 218
NmuCI GTSAC 1 cut(s) 47
RsaI GTAC 3 cut(s) 177, 213, 256
RsaNI GTAC 3 cut(s) 176, 212, 255
Sau3AI GATC 3 cut(s) 64, 107, 146
SduI GDGCHC 1 cut(s) 94
SetI ASST 5 cut(s) 47, 97, 181, 203, 213
Sse9I AATT 1 cut(s) 235
TaaI ACNGT 1 cut(s) 137
TasI AATT 1 cut(s) 235
TatI WGTACW 1 cut(s) 254
TseFI GTSAC 1 cut(s) 47
Tsp45I GTSAC 1 cut(s) 47
TspDTI ATGAA 3 cut(s) 44, 231, 264
XapI RAATTY 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.