Rmu_sc0006007.1_g000004

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006007.1
OG0013774
Physical Location & Seq
Reverse (-)
10764 .. 13887
3124 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006007.1_g000004.1.cds

Sequence Viewer

Length: 753 bp
atgcaaagactacccatggggtttggtccagtagtagcaagctgttcctacatgttgggcgaacgctacagtgatactcctggtagtaaggaggtcactgggtttcgcagtctgaattccttggcctgcgacgatggcattcacagtcctttgctggtgagtcctttgggctcgagaatctctcttcttcaaccatcgggttgctgcaccctaatctcagcgttttggatttgggattcaacccctacgggctttgcccgtgccgctgctactccctgtttcagtgatggtggtggacggaggagtcgtggtttggtggatccaaatcagacatgggatctcggtcctttcatgggaaaaggcactgagttcgggtcttctccgagggcggtgattcggagtcctggtgctaatcgagggttggagcgcttgggccaacatattgctatgggattctcattccagtgtcagcctaaccttggcggagatggaacggtgcagttcggtggggcagcgttgtggatcttgaaggattcaaatccggatcttggatccgagacagctacttatattgatctagtatttgttctggttcttgagagttcatttgctaattttcaagtttatgacaccttcggttactttcgaactcccggggaaggcagtgaagaagagggtcgcgatggcgatgctgatgaggacgaagatgatgcactgctcacgaagcatgtagcggattgggttggtctataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

250

Amino Acids

26.77

Weight (kDa)

4.54

Isoelectric Point (pI)

43.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 303
AccII CGCG 1 cut(s) 681
AccIII TCCGGA 1 cut(s) 541
AciI CCGC 4 cut(s) 264, 389, 483, 734
AclWI GGATC 7 cut(s) 314, 327, 345, 530, 546, 552, 559
AcsI RAATTY 1 cut(s) 115
AfeI AGCGCT 1 cut(s) 428
AfiI CCNNNNNNNGG 4 cut(s) 353, 479, 548, 659
AflIII ACRYGT 1 cut(s) 51
AgsI TTSAA 5 cut(s) 191, 240, 529, 537, 620
AjnI CCWGG 2 cut(s) 79, 403
AluBI AGCT 2 cut(s) 42, 563
AluI AGCT 2 cut(s) 42, 563
Alw26I GTCTC 1 cut(s) 551
AlwI GGATC 7 cut(s) 314, 327, 345, 530, 546, 552, 559
Ama87I CYCGRG 2 cut(s) 172, 653
Aor13HI TCCGGA 1 cut(s) 541
Aor51HI AGCGCT 1 cut(s) 428
AoxI GGCC 2 cut(s) 123, 433
ApeKI GCWGC 3 cut(s) 204, 266, 512
ApoI RAATTY 1 cut(s) 115
AspLEI GCGC 1 cut(s) 429
AspS9I GGNCC 3 cut(s) 26, 344, 433
AsuC2I CCSGG 2 cut(s) 654, 655
AsuHPI GGTGA 2 cut(s) 169, 403
AsuII TTCGAA 1 cut(s) 646
AvaI CYCGRG 2 cut(s) 172, 653
AvaII GGWCC 2 cut(s) 26, 344
BamHI GGATCC 2 cut(s) 319, 551
BanII GRGCYC 1 cut(s) 173
BbsI GAAGAC 1 cut(s) 369
BbvI GCAGC 3 cut(s) 191, 253, 524
BccI CCATC 5 cut(s) 128, 202, 281, 482, 677
BcgI CGANNNNNNTGC 6 cut(s) 352, 386, 671, 692, 705, 726
BciT130I CCWGG 2 cut(s) 81, 405
BcnI CCSGG 2 cut(s) 654, 655
BcoDI GTCTC 1 cut(s) 551
BfaI CTAG 1 cut(s) 578
BfmI CTRYAG 1 cut(s) 67
BfoI RGCGCY 1 cut(s) 430
BisI GCNGC 4 cut(s) 205, 264, 267, 513
BlsI GCNGC 4 cut(s) 206, 265, 268, 514
Bme1390I CCNGG 4 cut(s) 81, 405, 654, 655
Bme18I GGWCC 2 cut(s) 26, 344
BmeT110I CYCGRG 2 cut(s) 172, 653
BmgT120I GGNCC 3 cut(s) 26, 344, 433
BmiI GGNNCC 2 cut(s) 321, 553
BmrFI CCNGG 4 cut(s) 81, 405, 654, 655
BmrI ACTGGG 1 cut(s) 108
BmsI GCATC 2 cut(s) 679, 700
BmuI ACTGGG 1 cut(s) 108
BpiI GAAGAC 1 cut(s) 369
BplI GAGNNNNNCTC 2 cut(s) 166, 198
Bpu14I TTCGAA 1 cut(s) 646
BpuEI CTTGAG 1 cut(s) 617
BpuMI CCSGG 2 cut(s) 654, 655
BsaBI GATNNNNATC 2 cut(s) 324, 537
BsaJI CCNNGG 6 cut(s) 15, 120, 383, 478, 653, 654
BsaWI WCCGGW 1 cut(s) 541
BsaXI ACNNNNNCTCC 6 cut(s) 292, 295, 322, 325, 391, 421
Bsc4I CCNNNNNNNGG 4 cut(s) 353, 479, 548, 659
Bse1I ACTGG 3 cut(s) 29, 103, 463
Bse8I GATNNNNATC 2 cut(s) 324, 537
BseAI TCCGGA 1 cut(s) 541
BseBI CCWGG 2 cut(s) 81, 405
BseDI CCNNGG 6 cut(s) 15, 120, 383, 478, 653, 654
BseJI GATNNNNATC 2 cut(s) 324, 537
BseLI CCNNNNNNNGG 4 cut(s) 353, 479, 548, 659
BseMII CTCAG 2 cut(s) 231, 357
BseNI ACTGG 3 cut(s) 29, 103, 463
BseRI GAGGAG 1 cut(s) 316
BseXI GCAGC 3 cut(s) 191, 253, 524
BsgI GTGCAG 2 cut(s) 190, 518
Bsh1236I CGCG 1 cut(s) 681
BshFI GGCC 2 cut(s) 125, 435
BsiHKCI CYCGRG 2 cut(s) 172, 653
BsiSI CCGG 2 cut(s) 542, 654
BslI CCNNNNNNNGG 4 cut(s) 353, 479, 548, 659
BsmAI GTCTC 1 cut(s) 551
BsmI GAATGC 1 cut(s) 138
BsnI GGCC 2 cut(s) 125, 435
BsoBI CYCGRG 2 cut(s) 172, 653
Bsp119I TTCGAA 1 cut(s) 646
Bsp1286I GDGCHC 1 cut(s) 173
Bsp13I TCCGGA 1 cut(s) 541
Bsp143I GATC 6 cut(s) 319, 337, 522, 544, 551, 574
Bsp19I CCATGG 1 cut(s) 15
Bsp68I TCGCGA 1 cut(s) 681
BspACI CCGC 4 cut(s) 264, 389, 483, 734
BspANI GGCC 2 cut(s) 125, 435
BspCNI CTCAG 2 cut(s) 230, 358
BspEI TCCGGA 1 cut(s) 541
BspFNI CGCG 1 cut(s) 681
BspLI GGNNCC 2 cut(s) 321, 553
BspPI GGATC 7 cut(s) 314, 327, 345, 530, 546, 552, 559
BspT104I TTCGAA 1 cut(s) 646
BsrI ACTGG 3 cut(s) 29, 103, 463
BssECI CCNNGG 6 cut(s) 15, 120, 383, 478, 653, 654
BssMI GATC 6 cut(s) 319, 337, 522, 544, 551, 574
BssT1I CCWWGG 3 cut(s) 15, 120, 478
Bst2UI CCWGG 2 cut(s) 81, 405
Bst4CI ACNGT 3 cut(s) 71, 146, 496
Bst6I CTCTTC 2 cut(s) 189, 666
BstBI TTCGAA 1 cut(s) 646
BstC8I GCNNGC 2 cut(s) 40, 127
BstDEI CTNAG 2 cut(s) 217, 366
BstDSI CCRYGG 1 cut(s) 15
BstFNI CGCG 1 cut(s) 681
BstH2I RGCGCY 1 cut(s) 430
BstHHI GCGC 1 cut(s) 429
BstKTI GATC 6 cut(s) 322, 340, 525, 547, 554, 577
BstMAI GTCTC 1 cut(s) 551
BstMBI GATC 6 cut(s) 319, 337, 522, 544, 551, 574
BstMWI GCNNNNNNNGC 3 cut(s) 135, 263, 724
BstNI CCWGG 2 cut(s) 81, 405
BstNSI RCATGY 2 cut(s) 55, 731
BstSCI CCNGG 4 cut(s) 79, 403, 652, 653
BstSFI CTRYAG 1 cut(s) 67
BstUI CGCG 1 cut(s) 681
BstV1I GCAGC 3 cut(s) 191, 253, 524
BstV2I GAAGAC 1 cut(s) 369
BstX2I RGATCY 5 cut(s) 319, 337, 522, 544, 551
BstYI RGATCY 5 cut(s) 319, 337, 522, 544, 551
BsuRI GGCC 2 cut(s) 125, 435
BtgI CCRYGG 1 cut(s) 15
BtgZI GCGATG 2 cut(s) 696, 702
BtsI GCAGTG 2 cut(s) 670, 713
BtsIMutI CAGTG 7 cut(s) 76, 96, 289, 363, 470, 670, 713
BtuMI TCGCGA 1 cut(s) 681
Cac8I GCNNGC 2 cut(s) 40, 127
CfoI GCGC 1 cut(s) 429
Cfr13I GGNCC 3 cut(s) 26, 344, 433
Cfr9I CCCGGG 1 cut(s) 653
CviAII CATG 5 cut(s) 16, 52, 333, 352, 728
CviJI RGCY 7 cut(s) 42, 125, 171, 252, 435, 472, 563
CviKI_1 RGCY 7 cut(s) 42, 125, 171, 252, 435, 472, 563
DdeI CTNAG 2 cut(s) 217, 366
DpnI GATC 6 cut(s) 321, 339, 524, 546, 553, 576
DpnII GATC 6 cut(s) 319, 337, 522, 544, 551, 574
DrdI GACNNNNNNGTC 1 cut(s) 303
DseDI GACNNNNNNGTC 1 cut(s) 303
Eam1104I CTCTTC 2 cut(s) 189, 666
EarI CTCTTC 2 cut(s) 189, 666
EciI GGCGGA 1 cut(s) 498
Eco130I CCWWGG 3 cut(s) 15, 120, 478
Eco24I GRGCYC 1 cut(s) 173
Eco47I GGWCC 2 cut(s) 26, 344
Eco47III AGCGCT 1 cut(s) 428
Eco88I CYCGRG 2 cut(s) 172, 653
EcoRI GAATTC 1 cut(s) 115
EcoRII CCWGG 2 cut(s) 79, 403
EcoT14I CCWWGG 3 cut(s) 15, 120, 478
EcoT38I GRGCYC 1 cut(s) 173
ErhI CCWWGG 3 cut(s) 15, 120, 478
FaeI CATG 5 cut(s) 19, 55, 336, 355, 731
FatI CATG 5 cut(s) 15, 51, 332, 351, 727
Fnu4HI GCNGC 4 cut(s) 205, 264, 267, 513
FriOI GRGCYC 1 cut(s) 173
Fsp4HI GCNGC 4 cut(s) 205, 264, 267, 513
FspBI CTAG 1 cut(s) 578
GlaI GCGC 1 cut(s) 428
GluI GCNGC 4 cut(s) 205, 264, 267, 513
HaeII RGCGCY 1 cut(s) 430
HaeIII GGCC 2 cut(s) 125, 435
HapII CCGG 2 cut(s) 542, 654
HhaI GCGC 1 cut(s) 429
Hin1II CATG 5 cut(s) 19, 55, 336, 355, 731
Hin6I GCGC 1 cut(s) 427
HinP1I GCGC 1 cut(s) 427
HinfI GANTC 8 cut(s) 160, 177, 236, 304, 394, 400, 453, 533
HpaII CCGG 2 cut(s) 542, 654
HphI GGTGA 2 cut(s) 169, 403
Hpy166II GTNNAC 1 cut(s) 296
Hpy188I TCNGA 5 cut(s) 114, 330, 384, 399, 556
Hpy188III TCNNGA 6 cut(s) 174, 526, 542, 596, 680, 721
Hpy8I GTNNAC 1 cut(s) 296
Hpy99I CGWCG 1 cut(s) 134
HpyAV CCTTC 3 cut(s) 523, 643, 653
HpyCH4III ACNGT 3 cut(s) 71, 146, 496
HpyCH4V TGCA 4 cut(s) 4, 207, 499, 713
HpyF10VI GCNNNNNNNGC 3 cut(s) 135, 263, 724
HpyF3I CTNAG 2 cut(s) 217, 366
Hsp92II CATG 5 cut(s) 19, 55, 336, 355, 731
HspAI GCGC 1 cut(s) 427
Kpn2I TCCGGA 1 cut(s) 541
Kzo9I GATC 6 cut(s) 319, 337, 522, 544, 551, 574
LmnI GCTCC 1 cut(s) 424
Lsp1109I GCAGC 3 cut(s) 191, 253, 524
LweI GCATC 2 cut(s) 679, 700
MaeI CTAG 1 cut(s) 578
MaeIII GTNAC 2 cut(s) 94, 638
MalI GATC 6 cut(s) 321, 339, 524, 546, 553, 576
MboI GATC 6 cut(s) 319, 337, 522, 544, 551, 574
MboII GAAGA 6 cut(s) 176, 179, 369, 680, 683, 716
MflI RGATCY 5 cut(s) 319, 337, 522, 544, 551
MhlI GDGCHC 1 cut(s) 173
MluCI AATT 2 cut(s) 115, 613
MlyI GAGTC 3 cut(s) 169, 313, 409
MmeI TCCRAC 1 cut(s) 402
MnlI CCTC 6 cut(s) 85, 294, 378, 410, 667, 691
MroI TCCGGA 1 cut(s) 541
MslI CAYNNNNRTG 1 cut(s) 463
MspA1I CMGCKG 1 cut(s) 266
MspI CCGG 2 cut(s) 542, 654
MspR9I CCNGG 4 cut(s) 81, 405, 654, 655
Mva1269I GAATGC 1 cut(s) 138
MvaI CCWGG 2 cut(s) 81, 405
MvnI CGCG 1 cut(s) 681
MwoI GCNNNNNNNGC 3 cut(s) 135, 263, 724
NciI CCSGG 2 cut(s) 654, 655
NcoI CCATGG 1 cut(s) 15
NdeII GATC 6 cut(s) 319, 337, 522, 544, 551, 574
NlaIII CATG 5 cut(s) 19, 55, 336, 355, 731
NlaIV GGNNCC 2 cut(s) 321, 553
NmuCI GTSAC 1 cut(s) 94
NruI TCGCGA 1 cut(s) 681
NspI RCATGY 2 cut(s) 55, 731
NspV TTCGAA 1 cut(s) 646
PaeR7I CTCGAG 1 cut(s) 172
PciI ACATGT 1 cut(s) 51
PcsI WCGNNNNNNNCGW 1 cut(s) 304
PctI GAATGC 1 cut(s) 138
PfeI GAWTC 5 cut(s) 177, 236, 394, 453, 533
PkrI GCNGC 4 cut(s) 206, 265, 268, 514
PleI GAGTC 3 cut(s) 168, 312, 408
PpsI GAGTC 3 cut(s) 168, 312, 408
PscI ACATGT 1 cut(s) 51
Psp6I CCWGG 2 cut(s) 79, 403
PspGI CCWGG 2 cut(s) 79, 403
PspN4I GGNNCC 2 cut(s) 321, 553
PspPI GGNCC 3 cut(s) 26, 344, 433
PsuI RGATCY 5 cut(s) 319, 337, 522, 544, 551
RruI TCGCGA 1 cut(s) 681
RseI CAYNNNNRTG 1 cut(s) 463
SatI GCNGC 4 cut(s) 205, 264, 267, 513
Sau3AI GATC 6 cut(s) 319, 337, 522, 544, 551, 574
Sau96I GGNCC 3 cut(s) 26, 344, 433
SchI GAGTC 3 cut(s) 169, 313, 409
ScrFI CCNGG 4 cut(s) 81, 405, 654, 655
SduI GDGCHC 1 cut(s) 173
SetI ASST 5 cut(s) 44, 96, 480, 565, 635
SfaNI GCATC 2 cut(s) 679, 700
SfcI CTRYAG 1 cut(s) 67
Sfr274I CTCGAG 1 cut(s) 172
SfuI TTCGAA 1 cut(s) 646
SinI GGWCC 2 cut(s) 26, 344
SlaI CTCGAG 1 cut(s) 172
SmaI CCCGGG 1 cut(s) 655
SmiMI CAYNNNNRTG 1 cut(s) 463
SmlI CTYRAG 2 cut(s) 172, 596
SmoI CTYRAG 2 cut(s) 172, 596
Sse9I AATT 2 cut(s) 115, 613
SsiI CCGC 4 cut(s) 264, 389, 483, 734
SspMI CTAG 1 cut(s) 578
StyD4I CCNGG 4 cut(s) 79, 403, 652, 653
StyI CCWWGG 3 cut(s) 15, 120, 478
TaaI ACNGT 3 cut(s) 71, 146, 496
TaqI TCGA 3 cut(s) 173, 415, 646
TaqII GACCGA 1 cut(s) 332
TasI AATT 2 cut(s) 115, 613
TauI GCSGC 1 cut(s) 266
TfiI GAWTC 5 cut(s) 177, 236, 394, 453, 533
TscAI CASTG 7 cut(s) 76, 103, 289, 370, 470, 670, 720
TseFI GTSAC 1 cut(s) 94
TseI GCWGC 3 cut(s) 204, 266, 512
Tsp45I GTSAC 1 cut(s) 94
TspDTI ATGAA 2 cut(s) 340, 594
TspGWI ACGGA 1 cut(s) 313
TspMI CCCGGG 1 cut(s) 653
TspRI CASTG 7 cut(s) 76, 103, 289, 370, 470, 670, 720
VpaK11BI GGWCC 2 cut(s) 26, 344
XapI RAATTY 1 cut(s) 115
XceI RCATGY 2 cut(s) 55, 731
XcmI CCANNNNNNNNNTGG 1 cut(s) 330
XhoI CTCGAG 1 cut(s) 172
XmaI CCCGGG 1 cut(s) 653
XspI CTAG 1 cut(s) 578
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.