Rmu_sc0006028.1_g000017

Chaperone protein DNAj

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006028.1
Physical Location & Seq
Reverse (-)
64841 .. 66257
1417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006028.1_g000017.1.cds

Sequence Viewer

Length: 369 bp
atgctttgttcagatcctaagcttgattcacaccgctttaaggacattcttgatgaggcaatagcttcaggagaactgaaatcaaccaaagcctacacaaaatgggcaaagaaagtatctgaaacaaaacctcctactagtcctttaaagaggaagagcaagtcaagtaaacagtcagaaccagatctgtatgccatcatatctcagcgtaggaatgaaaggaaagaccagtttgagtctatgttctctaacctagtctctaagtatggcgggagtaatgatgcttcagaacccacagaagaagaatttgaggctacacagaaaaagcttgaaagcaaaaggtccaccagaaaatcaaaccgcaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

13.96

Weight (kDa)

9.59

Isoelectric Point (pI)

52.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 34, 270, 361
AclWI GGATC 1 cut(s) 8
AcsI RAATTY 1 cut(s) 305
AcuI CTGAAG 2 cut(s) 51, 270
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 1 cut(s) 332
AhlI ACTAGT 1 cut(s) 137
AluBI AGCT 3 cut(s) 22, 65, 328
AluI AGCT 3 cut(s) 22, 65, 328
Alw26I GTCTC 1 cut(s) 262
AlwI GGATC 1 cut(s) 8
ApoI RAATTY 1 cut(s) 305
AspS9I GGNCC 1 cut(s) 342
AvaII GGWCC 1 cut(s) 342
BarI GAAGNNNNNNTAC 2 cut(s) 268, 300
BccI CCATC 1 cut(s) 203
BcoDI GTCTC 1 cut(s) 262
BcuI ACTAGT 1 cut(s) 137
BfaI CTAG 2 cut(s) 138, 254
BglII AGATCT 1 cut(s) 184
Bme18I GGWCC 1 cut(s) 342
BmgT120I GGNCC 1 cut(s) 342
BmsI GCATC 1 cut(s) 271
Bpu10I CCTNAGC 1 cut(s) 18
BsaXI ACNNNNNCTCC 2 cut(s) 115, 145
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse1I ACTGG 1 cut(s) 229
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 218
BseNI ACTGG 1 cut(s) 229
BslI CCNNNNNNNGG 1 cut(s) 40
BsmAI GTCTC 1 cut(s) 262
Bsp143I GATC 2 cut(s) 13, 184
BspACI CCGC 3 cut(s) 34, 270, 361
BspCNI CTCAG 1 cut(s) 217
BspPI GGATC 1 cut(s) 8
BspQI GCTCTTC 1 cut(s) 149
BsrI ACTGG 1 cut(s) 229
BssMI GATC 2 cut(s) 13, 184
Bst4CI ACNGT 1 cut(s) 174
Bst6I CTCTTC 1 cut(s) 149
BstDEI CTNAG 3 cut(s) 18, 204, 261
BstKTI GATC 2 cut(s) 16, 187
BstMAI GTCTC 1 cut(s) 262
BstMBI GATC 2 cut(s) 13, 184
BstX2I RGATCY 2 cut(s) 13, 184
BstYI RGATCY 2 cut(s) 13, 184
Cfr13I GGNCC 1 cut(s) 342
CviJI RGCY 5 cut(s) 22, 65, 92, 314, 328
CviKI_1 RGCY 5 cut(s) 22, 65, 92, 314, 328
DdeI CTNAG 3 cut(s) 18, 204, 261
DpnI GATC 2 cut(s) 15, 186
DpnII GATC 2 cut(s) 13, 184
DraI TTTAAA 1 cut(s) 147
Eam1104I CTCTTC 1 cut(s) 149
EarI CTCTTC 1 cut(s) 149
Eco47I GGWCC 1 cut(s) 342
Eco57I CTGAAG 2 cut(s) 51, 270
FaiI YATR 4 cut(s) 192, 200, 242, 267
FauI CCCGC 1 cut(s) 263
FspBI CTAG 2 cut(s) 138, 254
HindIII AAGCTT 2 cut(s) 20, 326
HinfI GANTC 2 cut(s) 26, 236
Hpy166II GTNNAC 2 cut(s) 170, 345
Hpy188I TCNGA 4 cut(s) 13, 121, 178, 289
Hpy188III TCNNGA 2 cut(s) 50, 69
Hpy8I GTNNAC 2 cut(s) 170, 345
HpyCH4III ACNGT 1 cut(s) 174
HpyF3I CTNAG 3 cut(s) 18, 204, 261
Kzo9I GATC 2 cut(s) 13, 184
LguI GCTCTTC 1 cut(s) 149
LpnPI CCDG 4 cut(s) 54, 195, 242, 361
LweI GCATC 1 cut(s) 271
MaeI CTAG 2 cut(s) 138, 254
MalI GATC 2 cut(s) 15, 186
MboI GATC 2 cut(s) 13, 184
MboII GAAGA 3 cut(s) 166, 311, 314
MflI RGATCY 2 cut(s) 13, 184
MluCI AATT 1 cut(s) 305
MlyI GAGTC 1 cut(s) 245
MnlI CCTC 4 cut(s) 49, 141, 144, 304
MseI TTAA 2 cut(s) 39, 146
NdeII GATC 2 cut(s) 13, 184
PciSI GCTCTTC 1 cut(s) 149
PfeI GAWTC 1 cut(s) 26
PleI GAGTC 1 cut(s) 244
PpsI GAGTC 1 cut(s) 244
PspPI GGNCC 1 cut(s) 342
PsuI RGATCY 2 cut(s) 13, 184
SapI GCTCTTC 1 cut(s) 149
SaqAI TTAA 2 cut(s) 39, 146
Sau3AI GATC 2 cut(s) 13, 184
Sau96I GGNCC 1 cut(s) 342
SchI GAGTC 1 cut(s) 245
SetI ASST 6 cut(s) 24, 67, 133, 255, 330, 344
SfaNI GCATC 1 cut(s) 271
SinI GGWCC 1 cut(s) 342
SpeI ACTAGT 1 cut(s) 137
Sse9I AATT 1 cut(s) 305
SsiI CCGC 3 cut(s) 34, 270, 361
SspMI CTAG 2 cut(s) 138, 254
TaaI ACNGT 1 cut(s) 174
TasI AATT 1 cut(s) 305
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 2 cut(s) 39, 146
Tru9I TTAA 2 cut(s) 39, 146
TspDTI ATGAA 1 cut(s) 231
VpaK11BI GGWCC 1 cut(s) 342
XapI RAATTY 1 cut(s) 305
XspI CTAG 2 cut(s) 138, 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.