Rmu_sc0006186.1_g000002

ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006186.1
Physical Location & Seq
Forward (+)
11544 .. 12510
967 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006186.1_g000002.1.cds

Sequence Viewer

Length: 792 bp
atgggcttaaatctgcagatacaggagctagggcgtttggtttgcaatttggtgacagtggttcctgaaggaatcgttgtcttcttctcttcatttgattatgaaggagaggtgtacaatgcatgggaggcttcaggcatcctcgatagaattaagaagaagaagcgtctatttagagagcctaggaagaatacatatgtagaatctgttctgaaggagtacaaggaaacaattgataccttgtcttcaggagaaaggaaagaaaatccttctcagagtggtgccatacttcttgctgttgttggtggtaagatatcggagggcatcaacttgagtgatgggatgggtcggtgtatagtcatggttggactgccctatgcgagcccttctgatgttgagctgatggagagggtgaagcacattgaaagattgggaaattcaaattcgattaagatgaccaattctttacgtggtaatgaactttacagtggagaagcacatgaaggatttgatatcctccgaagttgcagacacagaggaaaagaatattatgagaatctttgcatgaaagctgtaaaccagtccatcggtagagcaatccggcatataaatgattatgcagcaattttactagttgatacacgctatgcagctgactcctcaacacggaatttcaggcatccaactagcaagctcccacagtggataaaggatcgttttgttgcttcaggagattacggccaacttcataggatgttgcatcagttttttagttataacaaaaagagatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

263

Amino Acids

29.92

Weight (kDa)

9.16

Isoelectric Point (pI)

38.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 777
AccB1I GGYRCC 1 cut(s) 281
AclWI GGATC 1 cut(s) 720
AcoI YGGCCR 1 cut(s) 739
AcsI RAATTY 3 cut(s) 436, 442, 670
AcuI CTGAAG 5 cut(s) 87, 117, 231, 233, 711
AfaI GTAC 2 cut(s) 116, 221
AfiI CCNNNNNNNGG 1 cut(s) 666
AgsI TTSAA 2 cut(s) 425, 441
AhlI ACTAGT 1 cut(s) 631
AluBI AGCT 5 cut(s) 28, 400, 572, 653, 694
AluI AGCT 5 cut(s) 28, 400, 572, 653, 694
AlwI GGATC 1 cut(s) 720
AoxI GGCC 1 cut(s) 739
ApeKI GCWGC 2 cut(s) 620, 650
ApoI RAATTY 3 cut(s) 436, 442, 670
Asp700I GAANNNNTTC 1 cut(s) 207
AspA2I CCTAGG 1 cut(s) 182
AsuHPI GGTGA 2 cut(s) 64, 424
AvrII CCTAGG 1 cut(s) 182
BanI GGYRCC 1 cut(s) 281
BanII GRGCYC 1 cut(s) 386
BbsI GAAGAC 2 cut(s) 73, 237
BbvI GCAGC 2 cut(s) 632, 662
BccI CCATC 4 cut(s) 332, 337, 397, 593
BceAI ACGGC 1 cut(s) 754
BcuI ACTAGT 1 cut(s) 631
BfaI CTAG 4 cut(s) 29, 183, 632, 687
BfmI CTRYAG 1 cut(s) 14
BisI GCNGC 2 cut(s) 621, 651
BlnI CCTAGG 1 cut(s) 182
BlsI GCNGC 2 cut(s) 622, 652
BmiI GGNNCC 2 cut(s) 63, 283
BmsI GCATC 4 cut(s) 147, 333, 688, 769
BpiI GAAGAC 2 cut(s) 73, 237
BpuEI CTTGAG 1 cut(s) 352
BsaAI YACGTR 1 cut(s) 470
BsaJI CCNNGG 1 cut(s) 182
Bsc4I CCNNNNNNNGG 1 cut(s) 666
Bse1I ACTGG 1 cut(s) 580
BseDI CCNNGG 1 cut(s) 182
BseGI GGATG 4 cut(s) 138, 348, 679, 759
BseLI CCNNNNNNNGG 1 cut(s) 666
BseMII CTCAG 1 cut(s) 287
BseNI ACTGG 1 cut(s) 580
BseRI GAGGAG 1 cut(s) 649
BseXI GCAGC 2 cut(s) 632, 662
BshFI GGCC 1 cut(s) 741
BshNI GGYRCC 1 cut(s) 281
BsiSI CCGG 1 cut(s) 601
BslI CCNNNNNNNGG 1 cut(s) 666
BsnI GGCC 1 cut(s) 741
Bsp1286I GDGCHC 1 cut(s) 386
Bsp1407I TGTACA 1 cut(s) 114
Bsp143I GATC 1 cut(s) 712
BspANI GGCC 1 cut(s) 741
BspCNI CTCAG 1 cut(s) 286
BspLI GGNNCC 2 cut(s) 63, 283
BspMAI CTGCAG 1 cut(s) 18
BspPI GGATC 1 cut(s) 720
BspT107I GGYRCC 1 cut(s) 281
BsrGI TGTACA 1 cut(s) 114
BsrI ACTGG 1 cut(s) 580
BssECI CCNNGG 1 cut(s) 182
BssMI GATC 1 cut(s) 712
BssT1I CCWWGG 1 cut(s) 182
Bst4CI ACNGT 3 cut(s) 58, 488, 702
Bst6I CTCTTC 1 cut(s) 94
BstAUI TGTACA 1 cut(s) 114
BstBAI YACGTR 1 cut(s) 470
BstC8I GCNNGC 2 cut(s) 382, 692
BstDEI CTNAG 1 cut(s) 273
BstF5I GGATG 4 cut(s) 138, 348, 679, 759
BstKTI GATC 1 cut(s) 715
BstMBI GATC 1 cut(s) 712
BstMWI GCNNNNNNNGC 1 cut(s) 128
BstSFI CTRYAG 1 cut(s) 14
BstV1I GCAGC 2 cut(s) 632, 662
BstV2I GAAGAC 2 cut(s) 73, 237
BsuRI GGCC 1 cut(s) 741
BtsCI GGATG 4 cut(s) 138, 348, 679, 759
BtsIMutI CAGTG 3 cut(s) 63, 493, 707
Cac8I GCNNGC 2 cut(s) 382, 692
CseI GACGC 1 cut(s) 155
Csp6I GTAC 2 cut(s) 115, 220
CviAII CATG 4 cut(s) 123, 361, 500, 565
CviQI GTAC 2 cut(s) 115, 220
DdeI CTNAG 1 cut(s) 273
DpnI GATC 1 cut(s) 714
DpnII GATC 1 cut(s) 712
EaeI YGGCCR 1 cut(s) 739
Eam1104I CTCTTC 1 cut(s) 94
EarI CTCTTC 1 cut(s) 94
Eco130I CCWWGG 1 cut(s) 182
Eco24I GRGCYC 1 cut(s) 386
Eco32I GATATC 2 cut(s) 315, 514
Eco57I CTGAAG 5 cut(s) 87, 117, 231, 233, 711
EcoRV GATATC 2 cut(s) 315, 514
EcoT14I CCWWGG 1 cut(s) 182
EcoT22I ATGCAT 1 cut(s) 124
EcoT38I GRGCYC 1 cut(s) 386
ErhI CCWWGG 1 cut(s) 182
FaeI CATG 4 cut(s) 126, 364, 503, 568
FatI CATG 4 cut(s) 122, 360, 499, 564
FauNDI CATATG 1 cut(s) 196
Fnu4HI GCNGC 2 cut(s) 621, 651
FokI GGATG 4 cut(s) 125, 355, 666, 766
FriOI GRGCYC 1 cut(s) 386
Fsp4HI GCNGC 2 cut(s) 621, 651
FspBI CTAG 4 cut(s) 29, 183, 632, 687
GluI GCNGC 2 cut(s) 621, 651
HaeIII GGCC 1 cut(s) 741
HapII CCGG 1 cut(s) 601
HgaI GACGC 1 cut(s) 155
Hin1II CATG 4 cut(s) 126, 364, 503, 568
HinfI GANTC 4 cut(s) 72, 203, 556, 656
HpaII CCGG 1 cut(s) 601
HphI GGTGA 2 cut(s) 64, 424
Hpy166II GTNNAC 2 cut(s) 115, 577
Hpy188I TCNGA 5 cut(s) 213, 276, 319, 391, 521
Hpy188III TCNNGA 3 cut(s) 65, 249, 729
Hpy8I GTNNAC 2 cut(s) 115, 577
HpyAV CCTTC 6 cut(s) 62, 98, 208, 279, 396, 497
HpyCH4III ACNGT 3 cut(s) 58, 488, 702
HpyCH4IV ACGT 1 cut(s) 469
HpyCH4V TGCA 8 cut(s) 16, 45, 122, 528, 564, 620, 650, 760
HpyF10VI GCNNNNNNNGC 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 273
HpySE526I ACGT 1 cut(s) 469
Hsp92II CATG 4 cut(s) 126, 364, 503, 568
Kzo9I GATC 1 cut(s) 712
LmnI GCTCC 2 cut(s) 25, 699
LpnPI CCDG 8 cut(s) 8, 78, 120, 234, 593, 614, 661, 714
Lsp1109I GCAGC 2 cut(s) 632, 662
LweI GCATC 4 cut(s) 147, 333, 688, 769
MaeI CTAG 4 cut(s) 29, 183, 632, 687
MaeII ACGT 1 cut(s) 469
MaeIII GTNAC 1 cut(s) 52
MalI GATC 1 cut(s) 714
MboI GATC 1 cut(s) 712
MboII GAAGA 7 cut(s) 73, 76, 81, 169, 172, 199, 237
MfeI CAATTG 1 cut(s) 231
MhlI GDGCHC 1 cut(s) 386
MluCI AATT 8 cut(s) 46, 150, 231, 436, 442, 460, 624, 670
MlyI GAGTC 1 cut(s) 650
MmeI TCCRAC 2 cut(s) 346, 707
MnlI CCTC 8 cut(s) 103, 121, 152, 313, 402, 527, 530, 670
Mph1103I ATGCAT 1 cut(s) 124
MroXI GAANNNNTTC 1 cut(s) 207
MseI TTAA 3 cut(s) 8, 153, 450
MslI CAYNNNNRTG 1 cut(s) 609
MspA1I CMGCKG 1 cut(s) 653
MspI CCGG 1 cut(s) 601
MunI CAATTG 1 cut(s) 231
MwoI GCNNNNNNNGC 1 cut(s) 128
NdeI CATATG 1 cut(s) 196
NdeII GATC 1 cut(s) 712
NlaIII CATG 4 cut(s) 126, 364, 503, 568
NlaIV GGNNCC 2 cut(s) 63, 283
NmuCI GTSAC 1 cut(s) 52
NsiI ATGCAT 1 cut(s) 124
PdmI GAANNNNTTC 1 cut(s) 207
PfeI GAWTC 3 cut(s) 72, 203, 556
PkrI GCNGC 2 cut(s) 622, 652
PleI GAGTC 1 cut(s) 650
PpsI GAGTC 1 cut(s) 650
Ppu21I YACGTR 1 cut(s) 470
PsiI TTATAA 1 cut(s) 777
PspN4I GGNNCC 2 cut(s) 63, 283
PsrI GAACNNNNNNTAC 2 cut(s) 192, 224
PstI CTGCAG 1 cut(s) 18
PvuII CAGCTG 1 cut(s) 653
RsaI GTAC 2 cut(s) 116, 221
RsaNI GTAC 2 cut(s) 115, 220
RseI CAYNNNNRTG 1 cut(s) 609
SaqAI TTAA 3 cut(s) 8, 153, 450
SatI GCNGC 2 cut(s) 621, 651
Sau3AI GATC 1 cut(s) 712
SchI GAGTC 1 cut(s) 650
SduI GDGCHC 1 cut(s) 386
SetI ASST 8 cut(s) 30, 114, 242, 402, 472, 574, 655, 696
SfaNI GCATC 4 cut(s) 147, 333, 688, 769
SfcI CTRYAG 1 cut(s) 14
SmiMI CAYNNNNRTG 1 cut(s) 609
SmlI CTYRAG 1 cut(s) 331
SmoI CTYRAG 1 cut(s) 331
SpeI ACTAGT 1 cut(s) 631
Sse9I AATT 8 cut(s) 46, 150, 231, 436, 442, 460, 624, 670
SspI AATATT 1 cut(s) 548
SspMI CTAG 4 cut(s) 29, 183, 632, 687
StyI CCWWGG 1 cut(s) 182
TaaI ACNGT 3 cut(s) 58, 488, 702
TaiI ACGT 1 cut(s) 472
TaqI TCGA 2 cut(s) 144, 446
TasI AATT 8 cut(s) 46, 150, 231, 436, 442, 460, 624, 670
TatI WGTACW 2 cut(s) 114, 219
TfiI GAWTC 3 cut(s) 72, 203, 556
Tru1I TTAA 3 cut(s) 8, 153, 450
Tru9I TTAA 3 cut(s) 8, 153, 450
TscAI CASTG 3 cut(s) 63, 493, 707
TseFI GTSAC 1 cut(s) 52
TseI GCWGC 2 cut(s) 620, 650
Tsp45I GTSAC 1 cut(s) 52
TspDTI ATGAA 6 cut(s) 81, 117, 492, 516, 581, 737
TspGWI ACGGA 1 cut(s) 682
TspRI CASTG 3 cut(s) 63, 493, 707
XapI RAATTY 3 cut(s) 436, 442, 670
XmaJI CCTAGG 1 cut(s) 182
XmnI GAANNNNTTC 1 cut(s) 207
XspI CTAG 4 cut(s) 29, 183, 632, 687
Zsp2I ATGCAT 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.