Rmu_sc0006493.1_g000007

Protein timeless homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006493.1
OG0015696
Physical Location & Seq
Reverse (-)
27512 .. 28317
806 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006493.1_g000007.1.cds

Sequence Viewer

Length: 456 bp
atggatccggatctgcgcaagctttttatcggcgggatatgcgaagactcagatggattcggatctgagcaagctttgtatcggcaggaattcatgggagacgtcggaggacaatctgaaggagtacttcggcaactaccgcaacgttttgcagacggtggttatgagagacatgatcactcaaaggcccagaggtatggcttatcggtgatctgtaacggcctcggaatcgccctagacgacgacggcggaaaccggatcggctacagaaagcacaagtactgcttagataatttgaaggatttgctgaggttcttgaggcgcgatgatccgcagaaccgggatgttttcaaggaagtatgcaagtggaatgttgtatctaaggatttgatacctattattgagcactgccaagatgatcgtagcttggttttaaatgcaggcaagttcttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TIMELESS TIMELESS_C

Protein Analysis

151

Amino Acids

17.19

Weight (kDa)

5.79

Isoelectric Point (pI)

37.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 105
Acc16I TGCGCA 1 cut(s) 17
AccII CGCG 1 cut(s) 324
AccIII TCCGGA 1 cut(s) 7
AciI CCGC 4 cut(s) 33, 140, 249, 332
AclI AACGTT 1 cut(s) 145
AclWI GGATC 5 cut(s) 12, 18, 70, 266, 323
AcsI RAATTY 1 cut(s) 89
AcuI CTGAAG 1 cut(s) 138
AcyI GRCGYC 1 cut(s) 102
AfaI GTAC 2 cut(s) 126, 281
AgsI TTSAA 2 cut(s) 298, 352
AluBI AGCT 3 cut(s) 22, 74, 426
AluI AGCT 3 cut(s) 22, 74, 426
Alw21I GWGCWC 1 cut(s) 408
Alw26I GTCTC 2 cut(s) 93, 163
AlwI GGATC 5 cut(s) 12, 18, 70, 266, 323
Aor13HI TCCGGA 1 cut(s) 7
AoxI GGCC 2 cut(s) 186, 220
ApoI RAATTY 1 cut(s) 89
AspLEI GCGC 2 cut(s) 18, 324
AspS9I GGNCC 1 cut(s) 187
AsuC2I CCSGG 1 cut(s) 341
AsuHPI GGTGA 1 cut(s) 220
BamHI GGATCC 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 51
Bbv12I GWGCWC 1 cut(s) 408
BbvCI CCTCAGC 1 cut(s) 308
BccI CCATC 1 cut(s) 47
BceAI ACGGC 2 cut(s) 235, 262
BclI TGATCA 1 cut(s) 175
BcnI CCSGG 1 cut(s) 341
BcoDI GTCTC 2 cut(s) 93, 163
BfaI CTAG 1 cut(s) 236
BfmI CTRYAG 1 cut(s) 265
BmcAI AGTACT 2 cut(s) 126, 281
Bme1390I CCNGG 1 cut(s) 341
BmgT120I GGNCC 1 cut(s) 187
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 341
BpiI GAAGAC 1 cut(s) 51
Bpu10I CCTNAGC 1 cut(s) 308
BpuEI CTTGAG 1 cut(s) 337
BpuMI CCSGG 1 cut(s) 341
BsaBI GATNNNNATC 2 cut(s) 9, 61
BsaHI GRCGYC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 223
BsaWI WCCGGW 2 cut(s) 7, 255
Bse8I GATNNNNATC 2 cut(s) 9, 61
BseAI TCCGGA 1 cut(s) 7
BseDI CCNNGG 1 cut(s) 223
BseGI GGATG 1 cut(s) 349
BseJI GATNNNNATC 2 cut(s) 9, 61
BseMII CTCAG 3 cut(s) 57, 63, 299
Bsh1236I CGCG 1 cut(s) 324
BshFI GGCC 2 cut(s) 188, 222
BsiHKAI GWGCWC 1 cut(s) 408
BsiSI CCGG 3 cut(s) 8, 256, 340
BsmAI GTCTC 2 cut(s) 93, 163
BsmBI CGTCTC 1 cut(s) 93
BsnI GGCC 2 cut(s) 188, 222
Bsp1286I GDGCHC 1 cut(s) 408
Bsp13I TCCGGA 1 cut(s) 7
Bsp143I GATC 8 cut(s) 4, 10, 62, 175, 210, 258, 328, 418
BspACI CCGC 4 cut(s) 33, 140, 249, 332
BspANI GGCC 2 cut(s) 188, 222
BspCNI CTCAG 3 cut(s) 58, 62, 300
BspEI TCCGGA 1 cut(s) 7
BspFNI CGCG 1 cut(s) 324
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 5 cut(s) 12, 18, 70, 266, 323
BssECI CCNNGG 1 cut(s) 223
BssMI GATC 8 cut(s) 4, 10, 62, 175, 210, 258, 328, 418
BssNI GRCGYC 1 cut(s) 102
Bst4CI ACNGT 1 cut(s) 158
BstACI GRCGYC 1 cut(s) 102
BstC8I GCNNGC 3 cut(s) 20, 72, 442
BstDEI CTNAG 5 cut(s) 49, 66, 286, 308, 381
BstF5I GGATG 1 cut(s) 349
BstFNI CGCG 1 cut(s) 324
BstHHI GCGC 2 cut(s) 18, 324
BstKTI GATC 8 cut(s) 7, 13, 65, 178, 213, 261, 331, 421
BstMAI GTCTC 2 cut(s) 93, 163
BstMBI GATC 8 cut(s) 4, 10, 62, 175, 210, 258, 328, 418
BstMWI GCNNNNNNNGC 2 cut(s) 39, 139
BstSCI CCNGG 1 cut(s) 339
BstSFI CTRYAG 1 cut(s) 265
BstUI CGCG 1 cut(s) 324
BstV2I GAAGAC 1 cut(s) 51
BstX2I RGATCY 3 cut(s) 4, 10, 62
BstXI CCANNNNNNTGG 1 cut(s) 197
BstYI RGATCY 3 cut(s) 4, 10, 62
BsuRI GGCC 2 cut(s) 188, 222
BtgZI GCGATG 1 cut(s) 339
BtsCI GGATG 1 cut(s) 349
BtsI GCAGTG 1 cut(s) 406
BtsIMutI CAGTG 1 cut(s) 406
Cac8I GCNNGC 3 cut(s) 20, 72, 442
CfoI GCGC 2 cut(s) 18, 324
Cfr13I GGNCC 1 cut(s) 187
Csp6I GTAC 2 cut(s) 125, 280
CviAII CATG 2 cut(s) 94, 173
CviJI RGCY 7 cut(s) 22, 74, 188, 201, 222, 264, 426
CviKI_1 RGCY 7 cut(s) 22, 74, 188, 201, 222, 264, 426
CviQI GTAC 2 cut(s) 125, 280
DdeI CTNAG 5 cut(s) 49, 66, 286, 308, 381
DpnI GATC 8 cut(s) 6, 12, 64, 177, 212, 260, 330, 420
DpnII GATC 8 cut(s) 4, 10, 62, 175, 210, 258, 328, 418
DraI TTTAAA 1 cut(s) 435
EciI GGCGGA 1 cut(s) 264
Eco57I CTGAAG 1 cut(s) 138
EcoRI GAATTC 1 cut(s) 89
Esp3I CGTCTC 1 cut(s) 93
FaeI CATG 2 cut(s) 97, 176
FaiI YATR 6 cut(s) 40, 95, 165, 174, 198, 361
FalI AAGNNNNNCTT 4 cut(s) 111, 143, 269, 301
FatI CATG 2 cut(s) 93, 172
FauI CCCGC 1 cut(s) 26
FbaI TGATCA 1 cut(s) 175
FokI GGATG 1 cut(s) 356
FspBI CTAG 1 cut(s) 236
FspI TGCGCA 1 cut(s) 17
GlaI GCGC 2 cut(s) 17, 323
HaeIII GGCC 2 cut(s) 188, 222
HapII CCGG 3 cut(s) 8, 256, 340
HhaI GCGC 2 cut(s) 18, 324
Hin1I GRCGYC 1 cut(s) 102
Hin1II CATG 2 cut(s) 97, 176
Hin6I GCGC 2 cut(s) 16, 322
HinP1I GCGC 2 cut(s) 16, 322
HindIII AAGCTT 2 cut(s) 20, 72
HinfI GANTC 3 cut(s) 47, 57, 228
HpaII CCGG 3 cut(s) 8, 256, 340
HphI GGTGA 1 cut(s) 220
Hpy188I TCNGA 6 cut(s) 52, 62, 67, 107, 118, 227
Hpy188III TCNNGA 2 cut(s) 8, 316
Hpy99I CGWCG 3 cut(s) 107, 245, 248
HpyAV CCTTC 2 cut(s) 113, 292
HpyCH4III ACNGT 1 cut(s) 158
HpyCH4IV ACGT 2 cut(s) 102, 145
HpyCH4V TGCA 3 cut(s) 152, 363, 440
HpyF10VI GCNNNNNNNGC 2 cut(s) 39, 139
HpyF3I CTNAG 5 cut(s) 49, 66, 286, 308, 381
HpySE526I ACGT 2 cut(s) 102, 145
Hsp92I GRCGYC 1 cut(s) 102
Hsp92II CATG 2 cut(s) 97, 176
HspAI GCGC 2 cut(s) 16, 322
Kpn2I TCCGGA 1 cut(s) 7
Ksp22I TGATCA 1 cut(s) 175
Kzo9I GATC 8 cut(s) 4, 10, 62, 175, 210, 258, 328, 418
LpnPI CCDG 6 cut(s) 21, 71, 203, 269, 353, 426
MaeI CTAG 1 cut(s) 236
MaeII ACGT 2 cut(s) 102, 145
MaeIII GTNAC 1 cut(s) 215
MalI GATC 8 cut(s) 6, 12, 64, 177, 212, 260, 330, 420
MboI GATC 8 cut(s) 4, 10, 62, 175, 210, 258, 328, 418
MboII GAAGA 1 cut(s) 56
MflI RGATCY 3 cut(s) 4, 10, 62
MhlI GDGCHC 1 cut(s) 408
MluCI AATT 2 cut(s) 89, 292
MlyI GAGTC 1 cut(s) 41
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 5 cut(s) 101, 186, 233, 303, 312
MroI TCCGGA 1 cut(s) 7
MseI TTAA 1 cut(s) 434
MspI CCGG 3 cut(s) 8, 256, 340
MspR9I CCNGG 1 cut(s) 341
MvnI CGCG 1 cut(s) 324
MwoI GCNNNNNNNGC 2 cut(s) 39, 139
NciI CCSGG 1 cut(s) 341
NdeII GATC 8 cut(s) 4, 10, 62, 175, 210, 258, 328, 418
NlaIII CATG 2 cut(s) 97, 176
NlaIV GGNNCC 1 cut(s) 6
NsbI TGCGCA 1 cut(s) 17
PcsI WCGNNNNNNNCGW 1 cut(s) 237
PfeI GAWTC 2 cut(s) 57, 228
PleI GAGTC 1 cut(s) 41
PpsI GAGTC 1 cut(s) 41
Psp1406I AACGTT 1 cut(s) 145
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 187
PsuI RGATCY 3 cut(s) 4, 10, 62
RsaI GTAC 2 cut(s) 126, 281
RsaNI GTAC 2 cut(s) 125, 280
SaqAI TTAA 1 cut(s) 434
Sau3AI GATC 8 cut(s) 4, 10, 62, 175, 210, 258, 328, 418
Sau96I GGNCC 1 cut(s) 187
ScaI AGTACT 2 cut(s) 126, 281
SchI GAGTC 1 cut(s) 41
ScrFI CCNGG 1 cut(s) 341
SduI GDGCHC 1 cut(s) 408
SetI ASST 8 cut(s) 24, 76, 105, 148, 197, 314, 397, 428
SfcI CTRYAG 1 cut(s) 265
SmlI CTYRAG 1 cut(s) 316
SmoI CTYRAG 1 cut(s) 316
Sse9I AATT 2 cut(s) 89, 292
SsiI CCGC 4 cut(s) 33, 140, 249, 332
SspMI CTAG 1 cut(s) 236
StyD4I CCNGG 1 cut(s) 339
TaaI ACNGT 1 cut(s) 158
TaiI ACGT 2 cut(s) 105, 148
TasI AATT 2 cut(s) 89, 292
TatI WGTACW 2 cut(s) 124, 279
TfiI GAWTC 2 cut(s) 57, 228
Tru1I TTAA 1 cut(s) 434
Tru9I TTAA 1 cut(s) 434
TscAI CASTG 1 cut(s) 413
TspDTI ATGAA 1 cut(s) 82
TspRI CASTG 1 cut(s) 413
XapI RAATTY 1 cut(s) 89
XspI CTAG 1 cut(s) 236
ZraI GACGTC 1 cut(s) 103
ZrmI AGTACT 2 cut(s) 126, 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.