Rmu_sc0024602.1_g000001

Heterogeneous nuclear ribonucleoprotein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0024602.1
OG0015696
Physical Location & Seq
Reverse (-)
2 .. 1515
1514 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0024602.1_g000001.1.cds

Sequence Viewer

Length: 241 bp
tgcctcctctcagatcttaattttcttcaaggtttggcatctgggttttcgttaatcggtgtgctgaattcaaaaggaaaaatgcaatccgatagtggcaagttattcattggtggcatatcttgggacacaaatgaagagcgtctcaaagagtatttcagtgcttttggggaggtggtagaagcagtgatcatgaaggatcggaccacaggacgtgctcgtggatttggttttgtagttt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003676 GO:0003723 GO:0005488 GO:0097159 GO:1901363
KEGG Pathways
Metabolic & Signaling
ko03015 map03015
Pfam Domains
Protein Families
RRM_1

Protein Analysis

80

Amino Acids

8.71

Weight (kDa)

6.39

Isoelectric Point (pI)

17.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 207
AcsI RAATTY 1 cut(s) 67
AgsI TTSAA 2 cut(s) 29, 72
AjiI CACGTC 1 cut(s) 215
Alw21I GWGCWC 1 cut(s) 220
Alw26I GTCTC 1 cut(s) 149
AlwI GGATC 1 cut(s) 207
ApoI RAATTY 1 cut(s) 67
AspS9I GGNCC 1 cut(s) 204
AvaII GGWCC 1 cut(s) 204
BauI CACGAG 1 cut(s) 219
Bbv12I GWGCWC 1 cut(s) 220
BclI TGATCA 1 cut(s) 189
BcoDI GTCTC 1 cut(s) 149
BglII AGATCT 1 cut(s) 13
Bme18I GGWCC 1 cut(s) 204
BmgBI CACGTC 1 cut(s) 215
BmgT120I GGNCC 1 cut(s) 204
BmsI GCATC 1 cut(s) 47
BseMII CTCAG 1 cut(s) 24
BsiHKAI GWGCWC 1 cut(s) 220
BslFI GGGAC 1 cut(s) 140
BsmAI GTCTC 1 cut(s) 149
BsmBI CGTCTC 1 cut(s) 149
BsmFI GGGAC 1 cut(s) 140
Bsp1286I GDGCHC 1 cut(s) 220
Bsp143I GATC 3 cut(s) 13, 189, 199
BspCNI CTCAG 1 cut(s) 23
BspHI TCATGA 1 cut(s) 192
BspPI GGATC 1 cut(s) 207
BspQI GCTCTTC 1 cut(s) 132
BssMI GATC 3 cut(s) 13, 189, 199
BssSI CACGAG 1 cut(s) 219
Bst2BI CACGAG 1 cut(s) 219
Bst6I CTCTTC 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 10
BstKTI GATC 3 cut(s) 16, 192, 202
BstMAI GTCTC 1 cut(s) 149
BstMBI GATC 3 cut(s) 13, 189, 199
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BtrI CACGTC 1 cut(s) 215
BtsI GCAGTG 1 cut(s) 192
BtsIMutI CAGTG 2 cut(s) 166, 192
CciI TCATGA 1 cut(s) 192
Cfr13I GGNCC 1 cut(s) 204
CseI GACGC 1 cut(s) 131
CviAII CATG 1 cut(s) 193
DdeI CTNAG 1 cut(s) 10
DpnI GATC 3 cut(s) 15, 191, 201
DpnII GATC 3 cut(s) 13, 189, 199
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
Eco47I GGWCC 1 cut(s) 204
EcoRI GAATTC 1 cut(s) 67
Esp3I CGTCTC 1 cut(s) 149
FaeI CATG 1 cut(s) 196
FaiI YATR 2 cut(s) 119, 194
FaqI GGGAC 1 cut(s) 140
FatI CATG 1 cut(s) 192
FbaI TGATCA 1 cut(s) 189
HgaI GACGC 1 cut(s) 131
Hin1II CATG 1 cut(s) 196
Hpy188I TCNGA 3 cut(s) 13, 91, 204
Hpy188III TCNNGA 1 cut(s) 193
HpyAV CCTTC 1 cut(s) 190
HpyCH4IV ACGT 1 cut(s) 214
HpyCH4V TGCA 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 10
HpySE526I ACGT 1 cut(s) 214
Hsp92II CATG 1 cut(s) 196
Ksp22I TGATCA 1 cut(s) 189
Kzo9I GATC 3 cut(s) 13, 189, 199
LguI GCTCTTC 1 cut(s) 132
LpnPI CCDG 2 cut(s) 27, 195
LweI GCATC 1 cut(s) 47
MaeII ACGT 1 cut(s) 214
MalI GATC 3 cut(s) 15, 191, 201
MboI GATC 3 cut(s) 13, 189, 199
MboII GAAGA 2 cut(s) 17, 149
MflI RGATCY 1 cut(s) 13
MhlI GDGCHC 1 cut(s) 220
MluCI AATT 2 cut(s) 19, 67
MnlI CCTC 3 cut(s) 14, 17, 166
MseI TTAA 2 cut(s) 18, 53
NdeII GATC 3 cut(s) 13, 189, 199
NlaIII CATG 1 cut(s) 196
PagI TCATGA 1 cut(s) 192
PciSI GCTCTTC 1 cut(s) 132
PspPI GGNCC 1 cut(s) 204
PsuI RGATCY 1 cut(s) 13
SapI GCTCTTC 1 cut(s) 132
SaqAI TTAA 2 cut(s) 18, 53
Sau3AI GATC 3 cut(s) 13, 189, 199
Sau96I GGNCC 1 cut(s) 204
SduI GDGCHC 1 cut(s) 220
SetI ASST 3 cut(s) 34, 177, 217
SfaNI GCATC 1 cut(s) 47
SgeI CNNG 9 cut(s) 41, 54, 112, 135, 205, 222, 227, 231, 233
SinI GGWCC 1 cut(s) 204
Sse9I AATT 2 cut(s) 19, 67
TaiI ACGT 1 cut(s) 217
TasI AATT 2 cut(s) 19, 67
Tru1I TTAA 2 cut(s) 18, 53
Tru9I TTAA 2 cut(s) 18, 53
TscAI CASTG 2 cut(s) 166, 192
TspDTI ATGAA 3 cut(s) 97, 150, 209
TspRI CASTG 2 cut(s) 166, 192
VpaK11BI GGWCC 1 cut(s) 204
XapI RAATTY 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.