Rroxscaffold_1G00049870

Heterogeneous nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
70187165 .. 70187984
820 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00049870.1

Sequence Viewer

Length: 204 bp
ATGAGAGACAATATCACTCCAAGGCCCAGATGTTTTGGGTTTGTGGTCTTTATAGTTGTAGATCCTGCTGTTCTTGATAGGGTTCTTCAGGAAAAGCATACCATCGCTTCTTTTTTTAACAAATTTAGATTCGATGGCTCAGATTGCGTTGACTTTTCCTTTTTTGTGGTTAAGGATTGCTGTGATTTTTCAGTTTTCTCTTAA

Protein Analysis

67

Amino Acids

7.78

Weight (kDa)

5.57

Isoelectric Point (pI)

22.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 56
AcsI RAATTY 1 cut(s) 122
AcuI CTGAAG 1 cut(s) 71
AlwI GGATC 1 cut(s) 56
AoxI GGCC 1 cut(s) 23
ApoI RAATTY 1 cut(s) 122
AspS9I GGNCC 1 cut(s) 24
BccI CCATC 2 cut(s) 110, 128
BmgT120I GGNCC 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 20
BseDI CCNNGG 1 cut(s) 20
BseMII CTCAG 1 cut(s) 153
BshFI GGCC 1 cut(s) 25
BsnI GGCC 1 cut(s) 25
Bsp143I GATC 1 cut(s) 61
BspANI GGCC 1 cut(s) 25
BspCNI CTCAG 1 cut(s) 152
BspPI GGATC 1 cut(s) 56
BssECI CCNNGG 1 cut(s) 20
BssMI GATC 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 139
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
BsuRI GGCC 1 cut(s) 25
BtgZI GCGATG 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 24
CviJI RGCY 2 cut(s) 25, 138
CviKI_1 RGCY 2 cut(s) 25, 138
DdeI CTNAG 1 cut(s) 139
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Eco130I CCWWGG 1 cut(s) 20
Eco57I CTGAAG 1 cut(s) 71
EcoT14I CCWWGG 1 cut(s) 20
ErhI CCWWGG 1 cut(s) 20
FaiI YATR 2 cut(s) 53, 99
HaeIII GGCC 1 cut(s) 25
HincII GTYRAC 1 cut(s) 151
HindII GTYRAC 1 cut(s) 151
HinfI GANTC 1 cut(s) 129
Hpy166II GTNNAC 1 cut(s) 151
Hpy188I TCNGA 1 cut(s) 142
Hpy188III TCNNGA 2 cut(s) 74, 89
Hpy8I GTNNAC 1 cut(s) 151
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
HpyF3I CTNAG 1 cut(s) 139
Kzo9I GATC 1 cut(s) 61
LpnPI CCDG 3 cut(s) 40, 74, 78
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 77
MflI RGATCY 1 cut(s) 61
MluCI AATT 1 cut(s) 122
MseI TTAA 3 cut(s) 117, 171, 202
MwoI GCNNNNNNNGC 1 cut(s) 144
NdeII GATC 1 cut(s) 61
PfeI GAWTC 1 cut(s) 129
PspPI GGNCC 1 cut(s) 24
PsuI RGATCY 1 cut(s) 61
SaqAI TTAA 3 cut(s) 117, 171, 202
Sau3AI GATC 1 cut(s) 61
Sau96I GGNCC 1 cut(s) 24
SgeI CNNG 5 cut(s) 33, 39, 77, 86, 101
Sse9I AATT 1 cut(s) 122
StyI CCWWGG 1 cut(s) 20
TaqI TCGA 1 cut(s) 132
TasI AATT 1 cut(s) 122
TfiI GAWTC 1 cut(s) 129
Tru1I TTAA 3 cut(s) 117, 171, 202
Tru9I TTAA 3 cut(s) 117, 171, 202
XapI RAATTY 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.