Rmu_sc0006590.1_g000007

GYF domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006590.1
Physical Location & Seq
Reverse (-)
18101 .. 26848
8748 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006590.1_g000007.1.cds

Sequence Viewer

Length: 5082 bp
atgcttaggcattttgacaaggtcaagcctccaagcacccccatgatcgttcgtagtcttgatcctgaaaaagatcattttcgtctgaaggatgatgaagaagatgtgctagaggcagaaatgtcttacatgagtacaataaacgcattattgtacttaccccaatgcataagaccgaacatctcatttcaccggagcttcaatccaatccgcagctttcttctccttttctcgatctccggcttcgtcactcttcgacctttttctatggcggaacgcaagctcaatctccccgacgatctcctctcctccaaaccctccgatcagtcctggacctccaaagttgaagtttctggaggaaatgatgaggaaaaggtgcttatggggtcatctgatgagttgaaagatccagcagccttggatagcagcatacctttgtcaccccagtggctttatgccaagccgattgaatctaagttggaaatgcgtggtccaacttcactcggaaactccactgacagcaaccagaaggacggttggcggttggaaggatctgaggacaagaaagattggaggcgacctgctactgaaagtgaaagtagccgtcgttggcgtgaagaggaaagagaaactagcttgcttggtggtagaagagatcgtaggaaaacagaacgccgtgctgacaatattccattgagggacacaactgacagtagagcattgcctacaactgacaggtggcatgatggccgcaatgaagtacggcgtgatagcaaatggtcgtctaggtggggtcctgaagacaaagaaaaggagccccgaactgagaagagaacagatgtggagaaggatgatgctcacagtaacagtgacagtcaatctcttggagctaacaaccgttcagctgctgagtcagattctcgggataaatggaggccacgacatagaatggaggttcaaactggggggtcagctacttaccgtgctgcacctggatttggactagaaagaggacgggtggagggttcgaatttgggatttaccgtggggcgcggaaggtcaagtggtattgggagatccgcaggcactattggctctgctctttcaggaaagagtgaaggtgtccctgggaaaccaaggcactcagctgatggtttttgctacccgaggggaaagcttcttgatatttatcggcagcgaaagcctgaactctcttttgataccatgccagatgagatggaggaggccccctcactaactcaagttgattttgttgaaccattggcttttcatgcccctgatgctgatgaggaggccatccttagcgatatatggaagggaaaaattacaagtagtggggtagtatacaattcattcagaaaggggagatcaactgaaaatattacaggtgtgggagacttagaagctgctgatggagttctgggcaatttgccctcgactgtcactcaagagactagcacctttcaggaggctgcaaatgctgatgactatgggactttgtggaattatggttcacagaggaatgtgataaatggaaaagatgttggtcataaagaaagtgataacagagctactgaaggaaaggaccttgatggaatttccctatcaactcaaaaaagtaatggtatctatggtgatgttgagactgatggttcttatgatagtgcaaatcagcttcatgttcgtggcaatgggaaaattggagattctgccttttcaaatcatcctgtatctgatgacattgagttggccaattattccgaaataagatccaaccttcccgacgtttcaaatactctctatggtttggcctcttctgagcagaatgagaatagcaaccctagagtgaaagagttagaaatgggtgttcatcctgagggtttgtattactactaccttgatcctcaaggggtgacccaagggccatatcaggggttagacatcatttcatggtttgaacaaggtttctttgggatagacttgcttgttcgcttggaggatgctcctgaaggaacacctttcaaagagttgggggagttcatgccatatcttaaatcttgggatgagaatggcagtatcataaatccaagttctaagctagaagaatctggtggcttaggagggagtctggagtccagtttacccttttctgcagcagtttcagacagtaactatgcatttctgggaaatgaccatcagcggcccatgcctgaactaaacagcctttcatctcagcatattcagccaagaatttccgagcctgaagctccagtacaactacattcaaggggtcaaagctttaatgattttgttgaacaagatgaagatattgtgtttcctggaatacatggaaccgctgcctattctactgcacgatcttctgggagcattcacgattctatggcaaactctattaatcaccttcctcccccaactgaaatgacagaatctggtgtgcctattcagaatgataataagttgcatccctttggcttgctatggtctgagctagaaagcggccaatcaaagcattccaagtcggccaatatgccatctagtaaggggagggctgttccatttggtgcaaatcctgatccagcaattgctgagacgtggtctgatcttcatagaaaaagttcagtctctgatccgaacttgtatcaggaaatgttgactcctcgccaattgtcgcacatggaacaggaacccagtcattatgatttagcagagcagcttatgtcgcagcaaattcgacagcagcagcaactccagcagcgaaatatgttgtctggttttgcacacttgaatgacaatgtattagatcctttgcaaaatcagaatcttattcaccatcaacagttagccaaccattctgcagcagatctggatcaccttttggcacttcagaggcaggctcagctcgagcaacatcaactgcaacaacagcagcagtttcatcaacagcagaagcttttacaggagcaacagcaatcacaagtacaacaggtgctttttgaacaattgttgcgtggtcaaatgcatgatcctacacttaggcagccacatgttgatcctgtaagagcaaacaatgttattgatcaggttctattagagcagcagcttctacgtgaacttcagcaacggtctcaccatcttccaaggcatgttgatccaactatagagcacttaattcaagcaaagtttggtcatacacctcaaggacatcaaacagatttgtttgagctactgtctcgtgcacagcatgaacagattcagtcgctggaacatcagatgcatgccaggcagttacccatgggaataaggcagcgaatggaagaagagaggcatatcagttctgtctggccagctgaggaatcaaatcagattttcaggacccatgctggtaatcatggtcaccgagggcactcttctggctttaatcctttagatttttatcagaggcagcagaggccatctcatgaggagcagctgaatcaccttgaccggaatctttcattacaggatcgacttcagcaaggtttttatgagcctggctcactaccgtttgagcggtcaatgtcattacctgctggtgcaccagggatgaacttggatgtagtaaatgctatggctcgtgcccagggtttagatatgcaggattccattggacgtatgcagtcggctggccagtcgggtcaattttcgtctggaatcccttcccacaatgctcatcatcctcatgttcctaaccaatttcatgtttcacatttggatgcaattgagggacactggcctgagaagaatgatcagcttgagaatgactggatggatgctcggtttcagcagctgcatattaatgctgagaggcagaaaagggaatcagagatcaagaatacttctcaggatcaaaatttatggatgtcagatggaattaatgatgagaactcaaagagactactaatggatttactccatcaaaaatctggccatcaacctagcgagtcgttgaatgcgatgagcaatgggatgttctctgataaaagactgccatctggccactactctggatcaagctcctcaaaccacctgttcaatctccatgcagaccaagaagcaggtctaaataactcatttcgtgtagggtcatttggttctaatccaggtgaactcctacaggaagagcaggccagcagtgtggaaagcaatgaaaagttgatgtatggatctaattctggagcattggctgatagagagtcatttctggcaggaatgaatgcaacgagccattcactttacacaaattctaacatgataagtaagtcttctataggtaaagaactttctgagttggagggcaggaagcgggggtccaaaggtgaggggataattatgggtcgatcttttgagactcaagaacgaatggttgaacaagcagggttgtctgcaacaaattttgaggagatgtcaaagcacgcccatagcatgaattcttcctccggtgtttcaggtgggaatgctggtttttatggtgacaagattggcggaagtaattcatttgtcgaacaaactgccaaggatcgggctcccatcccatccaaagggcaagaaaatattctgctgagacgaccttctgtcccaagtgcttcagcatcgcaagaaggattatcagaactgatatcagatccagttcttagaggaaaaaattcgagtgctgcttcggatggggcaaggcgagacgcagtggttaatccagtaaaccaaggttctgatgtcatggcatcttcgaaaaaagaaatgcatttccgccgtacatcatccgccagtgatgctgatgtatcagaggcatcatttatcgatatgcttaagagtaataccaagaagattgctcccatggatgcccacgccacagctggatttccagaatcatcggaagcaatgcaaggtggccggagtggcaaaaagaaaggaaagaaagggaggcaaattgatcctgccctccttggttttaaagtcaccagcaatcgtataatgatgggtgaaattcaacgaatcgacgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1693

Amino Acids

188.42

Weight (kDa)

5.6

Isoelectric Point (pI)

55.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 3 cut(s) 589, 3616, 4127
AccBSI CCGCTC 1 cut(s) 3592
AccI GTMKAC 1 cut(s) 1365
AccII CGCG 1 cut(s) 1053
AcoI YGGCCR 9 cut(s) 748, 1770, 2539, 2562, 3383, 3706, 4006, 4075, 4966
AcuI CTGAAG 9 cut(s) 107, 819, 1617, 2049, 2304, 2909, 3140, 3536, 4650
AfaI GTAC 6 cut(s) 136, 155, 762, 2295, 3021, 4831
AfiI CCNNNNNNNGG 4 cut(s) 998, 1952, 4599, 4619
AflII CTTAAG 1 cut(s) 4883
AflIII ACRYGT 1 cut(s) 3085
AhdI GACNNNNNGTC 1 cut(s) 4652
AjiI CACGTC 1 cut(s) 2634
AjnI CCWGG 9 cut(s) 329, 991, 1126, 2359, 3320, 3571, 3619, 3660, 4180
AleI CACNNNNGTG 1 cut(s) 445
AloI GAACNNNNNNTCC 2 cut(s) 1516, 1548
Alw21I GWGCWC 3 cut(s) 3207, 3280, 3619
Alw44I GTGCAC 2 cut(s) 3276, 3615
AlwNI CAGNNNCTG 5 cut(s) 908, 2471, 2666, 3301, 3868
Ama87I CYCGRG 3 cut(s) 921, 1165, 2942
ApaLI GTGCAC 2 cut(s) 3276, 3615
AseI ATTAAT 3 cut(s) 2436, 3876, 3954
Asp700I GAANNNNTTC 6 cut(s) 2656, 3291, 3736, 4570, 4632, 4723
AspLEI GCGC 1 cut(s) 1053
AspS9I GGNCC 9 cut(s) 333, 491, 794, 1246, 1606, 1943, 2223, 3414, 4389
AsuII TTCGAA 2 cut(s) 1028, 4805
AvaI CYCGRG 3 cut(s) 921, 1165, 2942
AvaII GGWCC 6 cut(s) 333, 491, 794, 1606, 3414, 4389
AxyI CCTNAGG 1 cut(s) 1896
BaeGI GKGCMC 4 cut(s) 3280, 3447, 3619, 3661
BalI TGGCCA 5 cut(s) 1772, 3385, 3708, 4008, 4077
BanII GRGCYC 2 cut(s) 819, 4606
BarI GAAGNNNNNNTAC 2 cut(s) 2277, 2309
BauI CACGAG 2 cut(s) 3273, 3654
BbsI GAAGAC 2 cut(s) 807, 4335
Bbv12I GWGCWC 3 cut(s) 3207, 3280, 3619
BbvCI CCTCAGC 1 cut(s) 3390
BceAI ACGGC 4 cut(s) 588, 660, 779, 4812
BcgI CGANNNNNNTGC 4 cut(s) 2753, 2787, 4571, 4605
BciT130I CCWGG 9 cut(s) 331, 993, 1128, 2361, 3322, 3573, 3621, 3662, 4182
BclI TGATCA 2 cut(s) 3118, 3826
BfmI CTRYAG 5 cut(s) 2172, 2895, 3198, 4193, 4347
BfrI CTTAAG 1 cut(s) 4883
BfuAI ACCTGC 3 cut(s) 589, 3616, 4127
BglI GCCNNNNNGGC 1 cut(s) 4974
BglII AGATCT 1 cut(s) 2902
BlpI GCTNAGC 1 cut(s) 2937
Bme1390I CCNGG 9 cut(s) 331, 993, 1128, 2361, 3322, 3573, 3621, 3662, 4182
Bme18I GGWCC 6 cut(s) 333, 491, 794, 1606, 3414, 4389
BmeRI GACNNNNNGTC 1 cut(s) 4652
BmeT110I CYCGRG 3 cut(s) 921, 1165, 2942
BmgBI CACGTC 1 cut(s) 2634
BmgT120I GGNCC 9 cut(s) 333, 491, 794, 1246, 1606, 1943, 2223, 3414, 4389
BmiI GGNNCC 8 cut(s) 795, 816, 1248, 2374, 2727, 3416, 4390, 4605
BmrFI CCNGG 9 cut(s) 331, 993, 1128, 2361, 3322, 3573, 3621, 3662, 4182
BmrI ACTGGG 3 cut(s) 439, 972, 2724
BmuI ACTGGG 3 cut(s) 439, 972, 2724
BpiI GAAGAC 2 cut(s) 807, 4335
BplI GAGNNNNNCTC 8 cut(s) 1235, 1267, 2920, 2952, 3481, 3513, 3560, 3592
BpmI CTGGAG 5 cut(s) 375, 2171, 2274, 2774, 4275
Bpu10I CCTNAGC 4 cut(s) 5, 1322, 2137, 3390
Bpu1102I GCTNAGC 1 cut(s) 2937
Bpu14I TTCGAA 2 cut(s) 1028, 4805
BpuEI CTTGAG 6 cut(s) 1245, 1452, 1911, 3222, 3854, 4416
Bsa29I ATCGAT 1 cut(s) 4875
BsaAI YACGTR 1 cut(s) 3149
BsaBI GATNNNNATC 3 cut(s) 1188, 2907, 3474
BsaI GGTCTC 1 cut(s) 3171
BsaWI WCCGGW 3 cut(s) 192, 3525, 4517
Bsc4I CCNNNNNNNGG 4 cut(s) 998, 1952, 4599, 4619
Bse21I CCTNAGG 1 cut(s) 1896
Bse3DI GCAATG 6 cut(s) 719, 760, 1717, 4048, 4231, 4962
Bse8I GATNNNNATC 3 cut(s) 1188, 2907, 3474
BseBI CCWGG 9 cut(s) 331, 993, 1128, 2361, 3322, 3573, 3621, 3662, 4182
BseCI ATCGAT 1 cut(s) 4875
BseJI GATNNNNATC 3 cut(s) 1188, 2907, 3474
BseLI CCNNNNNNNGG 4 cut(s) 998, 1952, 4599, 4619
BseMI GCAATG 6 cut(s) 719, 760, 1717, 4048, 4231, 4962
BseRI GAGGAG 8 cut(s) 293, 298, 1256, 1325, 2688, 3518, 4087, 4493
BseSI GKGCMC 4 cut(s) 3280, 3447, 3619, 3661
BsgI GTGCAG 2 cut(s) 972, 2376
Bsh1236I CGCG 1 cut(s) 1053
BshVI ATCGAT 1 cut(s) 4875
BsiHKAI GWGCWC 3 cut(s) 3207, 3280, 3619
BsiHKCI CYCGRG 3 cut(s) 921, 1165, 2942
BsiSI CCGG 5 cut(s) 193, 240, 3526, 4518, 4969
BslFI GGGAC 5 cut(s) 713, 1109, 1528, 3819, 4640
BslI CCNNNNNNNGG 4 cut(s) 998, 1952, 4599, 4619
BsmBI CGTCTC 3 cut(s) 2624, 4636, 4749
BsmFI GGGAC 5 cut(s) 713, 1109, 1528, 3819, 4640
BsmI GAATGC 5 cut(s) 2409, 2551, 4036, 4300, 4540
Bso31I GGTCTC 1 cut(s) 3171
BsoBI CYCGRG 3 cut(s) 921, 1165, 2942
Bsp119I TTCGAA 2 cut(s) 1028, 4805
Bsp1286I GDGCHC 7 cut(s) 819, 3207, 3280, 3447, 3619, 3661, 4606
Bsp1720I GCTNAGC 1 cut(s) 2937
Bsp19I CCATGG 2 cut(s) 3333, 4911
BspDI ATCGAT 1 cut(s) 4875
BspFNI CGCG 1 cut(s) 1053
BspHI TCATGA 1 cut(s) 3499
BspLI GGNNCC 8 cut(s) 795, 816, 1248, 2374, 2727, 3416, 4390, 4605
BspMAI CTGCAG 2 cut(s) 2176, 2899
BspMI ACCTGC 3 cut(s) 589, 3616, 4127
BspQI GCTCTTC 1 cut(s) 4194
BspT104I TTCGAA 2 cut(s) 1028, 4805
BspTI CTTAAG 1 cut(s) 4883
BspTNI GGTCTC 1 cut(s) 3171
BsrBI CCGCTC 1 cut(s) 3592
BsrDI GCAATG 6 cut(s) 719, 760, 1717, 4048, 4231, 4962
BssNAI GTATAC 1 cut(s) 1366
BssSI CACGAG 2 cut(s) 3273, 3654
BssT1I CCWWGG 9 cut(s) 417, 1136, 1939, 3179, 3333, 4593, 4780, 4911, 5020
Bst1107I GTATAC 1 cut(s) 1366
Bst2BI CACGAG 2 cut(s) 3273, 3654
Bst2UI CCWGG 9 cut(s) 331, 993, 1128, 2361, 3322, 3573, 3621, 3662, 4182
Bst6I CTCTTC 8 cut(s) 258, 612, 646, 824, 1840, 3354, 3454, 4194
BstAFI CTTAAG 1 cut(s) 4883
BstBAI YACGTR 1 cut(s) 3149
BstBI TTCGAA 2 cut(s) 1028, 4805
BstDSI CCRYGG 3 cut(s) 1044, 3333, 4911
BstEII GGTNACC 2 cut(s) 1933, 3434
BstFNI CGCG 1 cut(s) 1053
BstHHI GCGC 1 cut(s) 1053
BstNI CCWGG 9 cut(s) 331, 993, 1128, 2361, 3322, 3573, 3621, 3662, 4182
BstNSI RCATGY 3 cut(s) 3089, 3188, 3320
BstPI GGTNACC 2 cut(s) 1933, 3434
BstSCI CCNGG 9 cut(s) 329, 991, 1126, 2359, 3320, 3571, 3619, 3660, 4180
BstSFI CTRYAG 5 cut(s) 2172, 2895, 3198, 4193, 4347
BstSLI GKGCMC 4 cut(s) 3280, 3447, 3619, 3661
BstUI CGCG 1 cut(s) 1053
BstV2I GAAGAC 2 cut(s) 807, 4335
BstX2I RGATCY 8 cut(s) 406, 551, 1076, 1790, 2842, 2902, 4244, 4702
BstXI CCANNNNNNTGG 2 cut(s) 4085, 4216
BstYI RGATCY 8 cut(s) 406, 551, 1076, 1790, 2842, 2902, 4244, 4702
BstZ17I GTATAC 1 cut(s) 1366
Bsu15I ATCGAT 1 cut(s) 4875
Bsu36I CCTNAGG 1 cut(s) 1896
BsuTUI ATCGAT 1 cut(s) 4875
BtgI CCRYGG 3 cut(s) 1044, 3333, 4911
BtgZI GCGATG 2 cut(s) 4049, 4656
BtrI CACGTC 1 cut(s) 2634
BtsI GCAGTG 2 cut(s) 4219, 4767
BtsIMutI CAGTG 7 cut(s) 452, 513, 874, 3808, 4219, 4767, 4849
BveI ACCTGC 3 cut(s) 589, 3616, 4127
CaiI CAGNNNCTG 5 cut(s) 908, 2471, 2666, 3301, 3868
CciI TCATGA 1 cut(s) 3499
CfoI GCGC 1 cut(s) 1053
Cfr13I GGNCC 9 cut(s) 333, 491, 794, 1246, 1606, 1943, 2223, 3414, 4389
ClaI ATCGAT 1 cut(s) 4875
CseI GACGC 1 cut(s) 4766
Csp6I GTAC 6 cut(s) 135, 154, 761, 2294, 3020, 4830
CviQI GTAC 6 cut(s) 135, 154, 761, 2294, 3020, 4830
DraI TTTAAA 1 cut(s) 5029
DriI GACNNNNNGTC 1 cut(s) 4652
EaeI YGGCCR 9 cut(s) 748, 1770, 2539, 2562, 3383, 3706, 4006, 4075, 4966
Eam1104I CTCTTC 8 cut(s) 258, 612, 646, 824, 1840, 3354, 3454, 4194
Eam1105I GACNNNNNGTC 1 cut(s) 4652
EarI CTCTTC 8 cut(s) 258, 612, 646, 824, 1840, 3354, 3454, 4194
EciI GGCGGA 4 cut(s) 287, 4578, 4814, 4828
Eco130I CCWWGG 9 cut(s) 417, 1136, 1939, 3179, 3333, 4593, 4780, 4911, 5020
Eco24I GRGCYC 2 cut(s) 819, 4606
Eco31I GGTCTC 1 cut(s) 3171
Eco32I GATATC 1 cut(s) 4698
Eco47I GGWCC 6 cut(s) 333, 491, 794, 1606, 3414, 4389
Eco57I CTGAAG 9 cut(s) 107, 819, 1617, 2049, 2304, 2909, 3140, 3536, 4650
Eco81I CCTNAGG 1 cut(s) 1896
Eco88I CYCGRG 3 cut(s) 921, 1165, 2942
Eco91I GGTNACC 2 cut(s) 1933, 3434
EcoO109I RGGNCCY 4 cut(s) 794, 1246, 1606, 3414
EcoO65I GGTNACC 2 cut(s) 1933, 3434
EcoRI GAATTC 1 cut(s) 4507
EcoRII CCWGG 9 cut(s) 329, 991, 1126, 2359, 3320, 3571, 3619, 3660, 4180
EcoRV GATATC 1 cut(s) 4698
EcoT14I CCWWGG 9 cut(s) 417, 1136, 1939, 3179, 3333, 4593, 4780, 4911, 5020
EcoT22I ATGCAT 5 cut(s) 170, 2200, 3063, 3318, 4821
EcoT38I GRGCYC 2 cut(s) 819, 4606
ErhI CCWWGG 9 cut(s) 417, 1136, 1939, 3179, 3333, 4593, 4780, 4911, 5020
Esp3I CGTCTC 3 cut(s) 2624, 4636, 4749
FalI AAGNNNNNCTT 2 cut(s) 4327, 4359
FaqI GGGAC 5 cut(s) 713, 1109, 1528, 3819, 4640
FauI CCCGC 1 cut(s) 4377
FbaI TGATCA 2 cut(s) 3118, 3826
FblI GTMKAC 1 cut(s) 1365
FriOI GRGCYC 2 cut(s) 819, 4606
GlaI GCGC 1 cut(s) 1052
GsuI CTGGAG 5 cut(s) 375, 2171, 2274, 2774, 4275
HapII CCGG 5 cut(s) 193, 240, 3526, 4518, 4969
HgaI GACGC 1 cut(s) 4766
HhaI GCGC 1 cut(s) 1053
Hin6I GCGC 1 cut(s) 1051
HinP1I GCGC 1 cut(s) 1051
HincII GTYRAC 1 cut(s) 2694
HindII GTYRAC 1 cut(s) 2694
HindIII AAGCTT 3 cut(s) 1175, 2317, 2990
HpaII CCGG 5 cut(s) 193, 240, 3526, 4518, 4969
Hpy166II GTNNAC 9 cut(s) 1366, 1535, 2162, 2694, 3152, 3278, 3617, 4187, 4777
Hpy8I GTNNAC 9 cut(s) 1366, 1535, 2162, 2694, 3152, 3278, 3617, 4187, 4777
Hpy99I CGWCG 4 cut(s) 299, 609, 1808, 5078
HpyCH4IV ACGT 4 cut(s) 1806, 2633, 3148, 3691
HpySE526I ACGT 4 cut(s) 1806, 2633, 3148, 3691
HspAI GCGC 1 cut(s) 1051
Ksp22I TGATCA 2 cut(s) 3118, 3826
LguI GCTCTTC 1 cut(s) 4194
MaeII ACGT 4 cut(s) 1806, 2633, 3148, 3691
MbiI CCGCTC 1 cut(s) 3592
MfeI CAATTG 4 cut(s) 2622, 2705, 3041, 3798
MflI RGATCY 8 cut(s) 406, 551, 1076, 1790, 2842, 2902, 4244, 4702
MhlI GDGCHC 7 cut(s) 819, 3207, 3280, 3447, 3619, 3661, 4606
MlsI TGGCCA 5 cut(s) 1772, 3385, 3708, 4008, 4077
MluNI TGGCCA 5 cut(s) 1772, 3385, 3708, 4008, 4077
MlyI GAGTC 7 cut(s) 920, 2155, 2162, 2689, 4031, 4283, 4423
MmeI TCCRAC 6 cut(s) 459, 518, 525, 1818, 3218, 4350
Mox20I TGGCCA 5 cut(s) 1772, 3385, 3708, 4008, 4077
Mph1103I ATGCAT 5 cut(s) 170, 2200, 3063, 3318, 4821
MroXI GAANNNNTTC 6 cut(s) 2656, 3291, 3736, 4570, 4632, 4723
MscI TGGCCA 5 cut(s) 1772, 3385, 3708, 4008, 4077
MslI CAYNNNNRTG 7 cut(s) 41, 445, 1704, 2826, 3759, 3792, 3876
Msp20I TGGCCA 5 cut(s) 1772, 3385, 3708, 4008, 4077
MspA1I CMGCKG 8 cut(s) 905, 1148, 2221, 2378, 3389, 3511, 3868, 4931
MspCI CTTAAG 1 cut(s) 4883
MspI CCGG 5 cut(s) 193, 240, 3526, 4518, 4969
MspR9I CCNGG 9 cut(s) 331, 993, 1128, 2361, 3322, 3573, 3621, 3662, 4182
MunI CAATTG 4 cut(s) 2622, 2705, 3041, 3798
Mva1269I GAATGC 5 cut(s) 2409, 2551, 4036, 4300, 4540
MvaI CCWGG 9 cut(s) 331, 993, 1128, 2361, 3322, 3573, 3621, 3662, 4182
MvnI CGCG 1 cut(s) 1053
NcoI CCATGG 2 cut(s) 3333, 4911
NlaIV GGNNCC 8 cut(s) 795, 816, 1248, 2374, 2727, 3416, 4390, 4605
NmuCI GTSAC 8 cut(s) 247, 438, 869, 1462, 1933, 3434, 4550, 5032
NsiI ATGCAT 5 cut(s) 170, 2200, 3063, 3318, 4821
NspI RCATGY 3 cut(s) 3089, 3188, 3320
NspV TTCGAA 2 cut(s) 1028, 4805
OliI CACNNNNGTG 1 cut(s) 445
PaeI GCATGC 1 cut(s) 3320
PaeR7I CTCGAG 1 cut(s) 2942
PagI TCATGA 1 cut(s) 3499
PasI CCCWGGG 2 cut(s) 1127, 3661
PciI ACATGT 1 cut(s) 3085
PciSI GCTCTTC 1 cut(s) 4194
PcsI WCGNNNNNNNCGW 1 cut(s) 4031
PctI GAATGC 5 cut(s) 2409, 2551, 4036, 4300, 4540
PdmI GAANNNNTTC 6 cut(s) 2656, 3291, 3736, 4570, 4632, 4723
PflFI GACNNNGTC 2 cut(s) 20, 2635
PfoI TCCNGGA 2 cut(s) 329, 2359
PleI GAGTC 7 cut(s) 919, 2154, 2161, 2689, 4030, 4282, 4423
PpsI GAGTC 7 cut(s) 919, 2154, 2161, 2689, 4030, 4282, 4423
Ppu21I YACGTR 1 cut(s) 3149
PpuMI RGGWCCY 3 cut(s) 794, 1606, 3414
PscI ACATGT 1 cut(s) 3085
PshBI ATTAAT 3 cut(s) 2436, 3876, 3954
Psp5II RGGWCCY 3 cut(s) 794, 1606, 3414
Psp6I CCWGG 9 cut(s) 329, 991, 1126, 2359, 3320, 3571, 3619, 3660, 4180
PspEI GGTNACC 2 cut(s) 1933, 3434
PspGI CCWGG 9 cut(s) 329, 991, 1126, 2359, 3320, 3571, 3619, 3660, 4180
PspN4I GGNNCC 8 cut(s) 795, 816, 1248, 2374, 2727, 3416, 4390, 4605
PspPI GGNCC 9 cut(s) 333, 491, 794, 1246, 1606, 1943, 2223, 3414, 4389
PspPPI RGGWCCY 3 cut(s) 794, 1606, 3414
PspXI VCTCGAGB 1 cut(s) 2942
PstI CTGCAG 2 cut(s) 2176, 2899
PstNI CAGNNNCTG 5 cut(s) 908, 2471, 2666, 3301, 3868
PsuI RGATCY 8 cut(s) 406, 551, 1076, 1790, 2842, 2902, 4244, 4702
PsyI GACNNNGTC 2 cut(s) 20, 2635
PvuII CAGCTG 6 cut(s) 905, 1148, 3389, 3511, 3868, 4931
RsaI GTAC 6 cut(s) 136, 155, 762, 2295, 3021, 4831
RsaNI GTAC 6 cut(s) 135, 154, 761, 2294, 3020, 4830
RseI CAYNNNNRTG 7 cut(s) 41, 445, 1704, 2826, 3759, 3792, 3876
SapI GCTCTTC 1 cut(s) 4194
Sau96I GGNCC 9 cut(s) 333, 491, 794, 1246, 1606, 1943, 2223, 3414, 4389
SchI GAGTC 7 cut(s) 920, 2155, 2162, 2689, 4031, 4283, 4423
ScrFI CCNGG 9 cut(s) 331, 993, 1128, 2361, 3322, 3573, 3621, 3662, 4182
SduI GDGCHC 7 cut(s) 819, 3207, 3280, 3447, 3619, 3661, 4606
SfcI CTRYAG 5 cut(s) 2172, 2895, 3198, 4193, 4347
Sfr274I CTCGAG 1 cut(s) 2942
SfuI TTCGAA 2 cut(s) 1028, 4805
SinI GGWCC 6 cut(s) 333, 491, 794, 1606, 3414, 4389
SlaI CTCGAG 1 cut(s) 2942
SmiMI CAYNNNNRTG 7 cut(s) 41, 445, 1704, 2826, 3759, 3792, 3876
SmlI CTYRAG 8 cut(s) 1260, 1467, 1926, 2942, 3237, 3833, 4431, 4883
SmoI CTYRAG 8 cut(s) 1260, 1467, 1926, 2942, 3237, 3833, 4431, 4883
SphI GCATGC 1 cut(s) 3320
SspI AATATT 3 cut(s) 688, 1402, 4633
StyD4I CCNGG 9 cut(s) 329, 991, 1126, 2359, 3320, 3571, 3619, 3660, 4180
StyI CCWWGG 9 cut(s) 417, 1136, 1939, 3179, 3333, 4593, 4780, 4911, 5020
TaiI ACGT 4 cut(s) 1809, 2636, 3151, 3694
TaqII GACCGA 1 cut(s) 190
TatI WGTACW 4 cut(s) 134, 153, 2293, 3019
TauI GCSGC 3 cut(s) 753, 2224, 2541
TscAI CASTG 7 cut(s) 452, 520, 874, 3815, 4219, 4767, 4849
TseFI GTSAC 8 cut(s) 247, 438, 869, 1462, 1933, 3434, 4550, 5032
Tsp45I GTSAC 8 cut(s) 247, 438, 869, 1462, 1933, 3434, 4550, 5032
TspRI CASTG 7 cut(s) 452, 520, 874, 3815, 4219, 4767, 4849
Tth111I GACNNNGTC 2 cut(s) 20, 2635
Vha464I CTTAAG 1 cut(s) 4883
VneI GTGCAC 2 cut(s) 3276, 3615
VpaK11BI GGWCC 6 cut(s) 333, 491, 794, 1606, 3414, 4389
VspI ATTAAT 3 cut(s) 2436, 3876, 3954
XceI RCATGY 3 cut(s) 3089, 3188, 3320
XcmI CCANNNNNNNNNTGG 2 cut(s) 4001, 4928
XhoI CTCGAG 1 cut(s) 2942
XmiI GTMKAC 1 cut(s) 1365
XmnI GAANNNNTTC 6 cut(s) 2656, 3291, 3736, 4570, 4632, 4723
Zsp2I ATGCAT 5 cut(s) 170, 2200, 3063, 3318, 4821
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.