Rmu_sc0006835.1_g000006

Ribosome biogenesis regulatory protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006835.1
Physical Location & Seq
Reverse (-)
32210 .. 35176
2967 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006835.1_g000006.1.cds

Sequence Viewer

Length: 885 bp
atggagaccgatacgacggcgtttcaaatcgacgtgggtaatctcatggctgtggaccttcatcaccaattcccctccaacccttcttccagggaggaattggtgaaggaatatattgcaagaggaactgagttagttcaagctattgcgaataatctttttaatttgccttcgactgaagacattgagggtaccctcgtgaagttgcctgctccaacaactagattgcccagagagaagcatattccaaagcctaaacctcctacaaaatgggaacagtttgcccagaagaaaggtataaagaaccgtaagaaagacaagattgcatatgatgagtccagtgaaacttggaaacgtcgctatggatatgatcatgcaaatgatgaggataatgtgcctatcattgaggcaaagttgactgatgtgccaggggaggatccctttgctaaaagacgagaagataaaaagaaacgtgttgagaagcaagacaaaaacaggttgcagaacttgaagcaagctgctaaagttggtgctttgccaagtcatgttcaactagctgcgacaaggttgcctataacaggaacccaggccgcaacccaaaaggttactaaagatgaacttggtgatgtagctggaattgcagcaactgcaacagccagtggtggaaaatttgacaagaagttgccaggtgaaaaacctggtaaacataaaggaaagtatcgcaagtttttaccagttataggaggaaaagggatacacacgcaagagcaggagcaaaccgataaaattctgaacaagctaatctctaagaactcccatgagatgctcaatgttaacaaggtttgcttctcttttactggcattgggttctttcgacagcattag

Protein Analysis

294

Amino Acids

32.95

Weight (kDa)

9.56

Isoelectric Point (pI)

39.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 191
AccB1I GGYRCC 1 cut(s) 191
AciI CCGC 1 cut(s) 591
AclWI GGATC 2 cut(s) 431, 444
AcsI RAATTY 2 cut(s) 668, 786
AcuI CTGAAG 1 cut(s) 198
AfaI GTAC 1 cut(s) 193
AfiI CCNNNNNNNGG 2 cut(s) 578, 740
AflIII ACRYGT 1 cut(s) 472
AgsI TTSAA 4 cut(s) 26, 140, 511, 551
AjiI CACGTC 1 cut(s) 34
AjnI CCWGG 5 cut(s) 89, 427, 585, 685, 697
AluBI AGCT 5 cut(s) 143, 518, 557, 632, 799
AluI AGCT 5 cut(s) 143, 518, 557, 632, 799
AlwI GGATC 2 cut(s) 431, 444
AlwNI CAGNNNCTG 1 cut(s) 647
AoxI GGCC 1 cut(s) 588
ApeKI GCWGC 3 cut(s) 518, 557, 641
ApoI RAATTY 2 cut(s) 668, 786
Asp718I GGTACC 1 cut(s) 191
AspS9I GGNCC 1 cut(s) 55
AsuHPI GGTGA 4 cut(s) 56, 115, 635, 701
AvaII GGWCC 1 cut(s) 55
BaeI ACNNNNGTAYC 2 cut(s) 183, 216
BamHI GGATCC 1 cut(s) 436
BanI GGYRCC 1 cut(s) 191
BauI CACGAG 1 cut(s) 197
BbsI GAAGAC 1 cut(s) 186
BbvI GCAGC 3 cut(s) 505, 544, 653
BceAI ACGGC 1 cut(s) 33
BcgI CGANNNNNNTGC 2 cut(s) 550, 584
BciT130I CCWGG 5 cut(s) 91, 429, 587, 687, 699
BciVI GTATCC 1 cut(s) 747
BclI TGATCA 1 cut(s) 370
BfaI CTAG 2 cut(s) 222, 554
BfuI GTATCC 1 cut(s) 747
BisI GCNGC 4 cut(s) 519, 558, 591, 642
BlsI GCNGC 4 cut(s) 520, 559, 592, 643
Bme1390I CCNGG 5 cut(s) 91, 429, 587, 687, 699
Bme18I GGWCC 1 cut(s) 55
BmgBI CACGTC 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 55
BmiI GGNNCC 3 cut(s) 193, 438, 583
BmrFI CCNGG 5 cut(s) 91, 429, 587, 687, 699
BmsI GCATC 1 cut(s) 813
BpiI GAAGAC 1 cut(s) 186
BsaJI CCNNGG 3 cut(s) 90, 428, 585
Bsc4I CCNNNNNNNGG 2 cut(s) 578, 740
Bse1I ACTGG 4 cut(s) 339, 657, 734, 862
BseBI CCWGG 5 cut(s) 91, 429, 587, 687, 699
BseDI CCNNGG 3 cut(s) 90, 428, 585
BseLI CCNNNNNNNGG 2 cut(s) 578, 740
BseMII CTCAG 1 cut(s) 120
BseNI ACTGG 4 cut(s) 339, 657, 734, 862
BseXI GCAGC 3 cut(s) 505, 544, 653
BshFI GGCC 1 cut(s) 590
BshNI GGYRCC 1 cut(s) 191
BslI CCNNNNNNNGG 2 cut(s) 578, 740
BsnI GGCC 1 cut(s) 590
Bsp143I GATC 2 cut(s) 370, 436
BspACI CCGC 1 cut(s) 591
BspANI GGCC 1 cut(s) 590
BspCNI CTCAG 1 cut(s) 121
BspLI GGNNCC 3 cut(s) 193, 438, 583
BspPI GGATC 2 cut(s) 431, 444
BspT107I GGYRCC 1 cut(s) 191
BsrI ACTGG 4 cut(s) 339, 657, 734, 862
BssECI CCNNGG 3 cut(s) 90, 428, 585
BssMI GATC 2 cut(s) 370, 436
BssSI CACGAG 1 cut(s) 197
Bst2BI CACGAG 1 cut(s) 197
Bst2UI CCWGG 5 cut(s) 91, 429, 587, 687, 699
Bst4CI ACNGT 2 cut(s) 279, 308
BstAPI GCANNNNNTGC 1 cut(s) 647
BstC8I GCNNGC 2 cut(s) 210, 516
BstDEI CTNAG 2 cut(s) 129, 807
BstENI CCTNNNNNAGG 1 cut(s) 576
BstKTI GATC 2 cut(s) 373, 439
BstMBI GATC 2 cut(s) 370, 436
BstMWI GCNNNNNNNGC 2 cut(s) 638, 647
BstNI CCWGG 5 cut(s) 91, 429, 587, 687, 699
BstSCI CCNGG 5 cut(s) 89, 427, 585, 685, 697
BstV1I GCAGC 3 cut(s) 505, 544, 653
BstV2I GAAGAC 1 cut(s) 186
BstX2I RGATCY 1 cut(s) 436
BstYI RGATCY 1 cut(s) 436
BsuI GTATCC 1 cut(s) 747
BsuRI GGCC 1 cut(s) 590
BtrI CACGTC 1 cut(s) 34
BtsIMutI CAGTG 2 cut(s) 346, 664
Cac8I GCNNGC 2 cut(s) 210, 516
CaiI CAGNNNCTG 1 cut(s) 647
Cfr13I GGNCC 1 cut(s) 55
CsiI ACCWGGT 1 cut(s) 697
Csp6I GTAC 1 cut(s) 192
CviAII CATG 4 cut(s) 46, 374, 545, 818
CviJI RGCY 9 cut(s) 50, 143, 253, 518, 557, 590, 632, 656, 799
CviKI_1 RGCY 9 cut(s) 50, 143, 253, 518, 557, 590, 632, 656, 799
CviQI GTAC 1 cut(s) 192
DdeI CTNAG 2 cut(s) 129, 807
DpnI GATC 2 cut(s) 372, 438
DpnII GATC 2 cut(s) 370, 436
Eco47I GGWCC 1 cut(s) 55
Eco57I CTGAAG 1 cut(s) 198
EcoNI CCTNNNNNAGG 1 cut(s) 576
EcoRII CCWGG 5 cut(s) 89, 427, 585, 685, 697
FaeI CATG 4 cut(s) 49, 377, 548, 821
FalI AAGNNNNNCTT 4 cut(s) 603, 635, 830, 862
FatI CATG 4 cut(s) 45, 373, 544, 817
FauNDI CATATG 1 cut(s) 328
FbaI TGATCA 1 cut(s) 370
Fnu4HI GCNGC 4 cut(s) 519, 558, 591, 642
Fsp4HI GCNGC 4 cut(s) 519, 558, 591, 642
FspBI CTAG 2 cut(s) 222, 554
GluI GCNGC 4 cut(s) 519, 558, 591, 642
HaeIII GGCC 1 cut(s) 590
Hin1II CATG 4 cut(s) 49, 377, 548, 821
HincII GTYRAC 2 cut(s) 417, 835
HindII GTYRAC 2 cut(s) 417, 835
HinfI GANTC 1 cut(s) 335
HpaI GTTAAC 1 cut(s) 835
HphI GGTGA 4 cut(s) 56, 115, 635, 701
Hpy166II GTNNAC 4 cut(s) 55, 417, 704, 835
Hpy188I TCNGA 1 cut(s) 792
Hpy188III TCNNGA 1 cut(s) 199
Hpy8I GTNNAC 4 cut(s) 55, 417, 704, 835
Hpy99I CGWCG 3 cut(s) 19, 35, 360
HpyAV CCTTC 4 cut(s) 68, 93, 100, 180
HpyCH4III ACNGT 2 cut(s) 279, 308
HpyCH4IV ACGT 3 cut(s) 33, 355, 472
HpyCH4V TGCA 6 cut(s) 119, 326, 377, 502, 641, 650
HpyF10VI GCNNNNNNNGC 2 cut(s) 638, 647
HpyF3I CTNAG 2 cut(s) 129, 807
HpySE526I ACGT 3 cut(s) 33, 355, 472
Hsp92II CATG 4 cut(s) 49, 377, 548, 821
KpnI GGTACC 1 cut(s) 195
Ksp22I TGATCA 1 cut(s) 370
KspAI GTTAAC 1 cut(s) 835
Kzo9I GATC 2 cut(s) 370, 436
LmnI GCTCC 2 cut(s) 217, 772
Lsp1109I GCAGC 3 cut(s) 505, 544, 653
LweI GCATC 1 cut(s) 813
MabI ACCWGGT 1 cut(s) 697
MaeI CTAG 2 cut(s) 222, 554
MaeII ACGT 3 cut(s) 33, 355, 472
MaeIII GTNAC 1 cut(s) 604
MalI GATC 2 cut(s) 372, 438
MboI GATC 2 cut(s) 370, 436
MboII GAAGA 4 cut(s) 78, 191, 301, 470
MflI RGATCY 1 cut(s) 436
MluCI AATT 6 cut(s) 68, 98, 163, 636, 668, 786
MlyI GAGTC 1 cut(s) 344
MmeI TCCRAC 2 cut(s) 102, 239
MseI TTAA 2 cut(s) 162, 834
MslI CAYNNNNRTG 2 cut(s) 50, 378
MspR9I CCNGG 5 cut(s) 91, 429, 587, 687, 699
MvaI CCWGG 5 cut(s) 91, 429, 587, 687, 699
MwoI GCNNNNNNNGC 2 cut(s) 638, 647
NdeI CATATG 1 cut(s) 328
NdeII GATC 2 cut(s) 370, 436
NlaIII CATG 4 cut(s) 49, 377, 548, 821
NlaIV GGNNCC 3 cut(s) 193, 438, 583
PkrI GCNGC 4 cut(s) 520, 559, 592, 643
PleI GAGTC 1 cut(s) 343
PpsI GAGTC 1 cut(s) 343
Psp6I CCWGG 5 cut(s) 89, 427, 585, 685, 697
PspGI CCWGG 5 cut(s) 89, 427, 585, 685, 697
PspN4I GGNNCC 3 cut(s) 193, 438, 583
PspPI GGNCC 1 cut(s) 55
PstNI CAGNNNCTG 1 cut(s) 647
PsuI RGATCY 1 cut(s) 436
RsaI GTAC 1 cut(s) 193
RsaNI GTAC 1 cut(s) 192
RseI CAYNNNNRTG 2 cut(s) 50, 378
SaqAI TTAA 2 cut(s) 162, 834
SatI GCNGC 4 cut(s) 519, 558, 591, 642
Sau3AI GATC 2 cut(s) 370, 436
Sau96I GGNCC 1 cut(s) 55
SchI GAGTC 1 cut(s) 344
ScrFI CCNGG 5 cut(s) 91, 429, 587, 687, 699
SexAI ACCWGGT 1 cut(s) 697
SfaNI GCATC 1 cut(s) 813
SinI GGWCC 1 cut(s) 55
SmiMI CAYNNNNRTG 2 cut(s) 50, 378
Sse9I AATT 6 cut(s) 68, 98, 163, 636, 668, 786
SsiI CCGC 1 cut(s) 591
SspMI CTAG 2 cut(s) 222, 554
StyD4I CCNGG 5 cut(s) 89, 427, 585, 685, 697
TaaI ACNGT 2 cut(s) 279, 308
TaiI ACGT 3 cut(s) 36, 358, 475
TaqI TCGA 3 cut(s) 30, 173, 874
TaqII GACCGA 1 cut(s) 23
TasI AATT 6 cut(s) 68, 98, 163, 636, 668, 786
TauI GCSGC 1 cut(s) 593
Tru1I TTAA 2 cut(s) 162, 834
Tru9I TTAA 2 cut(s) 162, 834
TscAI CASTG 2 cut(s) 346, 664
TseI GCWGC 3 cut(s) 518, 557, 641
TspDTI ATGAA 2 cut(s) 50, 630
TspRI CASTG 2 cut(s) 346, 664
VpaK11BI GGWCC 1 cut(s) 55
XagI CCTNNNNNAGG 1 cut(s) 576
XapI RAATTY 2 cut(s) 668, 786
XcmI CCANNNNNNNNNTGG 1 cut(s) 97
XspI CTAG 2 cut(s) 222, 554
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.