Rmu_sc0006911.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006911.1
Physical Location & Seq
Forward (+)
24 .. 881
858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006911.1_g000001.1.cds

Sequence Viewer

Length: 858 bp
atggtcagtgtgctttcagcctgtgctcaagttggcgatttagagcttggtaggtgggttcatgaatacttgaaatctaaaggaaatagaggtgtgattggatcaaacagaattctagccactgcattgattgacatgtattccaaatgtgggagtttggagaaggcaaaagaggtttttcatcagatggtgtcgaaagacattgtttcattcaatgctatgatcatgggtcttgcagttaacagtgaaggagaggaagccctgaggctattctcaaaaatccaagattttggtttacaacccaatgctggtaccttccttggtgctttatgtgcatgcaaccactcaggtttttcagaggaagggcatcaaatattcaaggatatgacctcaggcttttccatttcacctaaattagaacattatgcctgctatattgatctccttgcccgagtaggcctagttgaagaagctctcgaggttgtaacttccatgccttttgagcctaacagtattgtgtggggtgctctgcttggaggttgcctgctccactctagattagactatgctgaatatgtttcccgtaaacttgttcaatctgaccccaacaataccgggggttatgtcatgctggctaatgcatttgcgtctgatcatcgatggggtgatgtctcttctctgaggcggtttatgagggaaaagggagtgaccaagcagcctggctgtagttggatcagcattaatggtgttgtgcatgaatttcttgttggatgctcatcacattctcaaagtgaaagtataagtagcatactaaatggattggtgaaacaaatgaagatagcaattgacatactatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

285

Amino Acids

31.15

Weight (kDa)

6.14

Isoelectric Point (pI)

41.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014644)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 311
AccB1I GGYRCC 1 cut(s) 311
AciI CCGC 1 cut(s) 685
AclWI GGATC 2 cut(s) 109, 740
AcsI RAATTY 2 cut(s) 111, 758
AfaI GTAC 1 cut(s) 313
AfiI CCNNNNNNNGG 2 cut(s) 150, 308
AflIII ACRYGT 1 cut(s) 135
AgsI TTSAA 5 cut(s) 73, 214, 379, 467, 596
AjnI CCWGG 1 cut(s) 718
AjuI GAANNNNNNNTTGG 2 cut(s) 750, 782
AluBI AGCT 2 cut(s) 46, 473
AluI AGCT 2 cut(s) 46, 473
Alw21I GWGCWC 2 cut(s) 28, 529
Alw26I GTCTC 1 cut(s) 676
AlwI GGATC 2 cut(s) 109, 740
Ama87I CYCGRG 2 cut(s) 450, 476
AoxI GGCC 1 cut(s) 457
ApeKI GCWGC 1 cut(s) 715
ApoI RAATTY 2 cut(s) 111, 758
AseI ATTAAT 1 cut(s) 741
Asp718I GGTACC 1 cut(s) 311
AsuC2I CCSGG 1 cut(s) 616
AsuHPI GGTGA 3 cut(s) 399, 677, 835
AvaI CYCGRG 2 cut(s) 450, 476
AxyI CCTNAGG 2 cut(s) 263, 391
BanI GGYRCC 1 cut(s) 311
Bbv12I GWGCWC 2 cut(s) 28, 529
BbvI GCAGC 1 cut(s) 727
BccI CCATC 2 cut(s) 181, 654
BciT130I CCWGG 1 cut(s) 720
BclI TGATCA 2 cut(s) 222, 652
BcnI CCSGG 1 cut(s) 616
BcoDI GTCTC 1 cut(s) 676
BfaI CTAG 3 cut(s) 116, 461, 555
BfmI CTRYAG 1 cut(s) 724
BisI GCNGC 1 cut(s) 716
BlsI GCNGC 1 cut(s) 717
Bme1390I CCNGG 2 cut(s) 616, 720
BmeT110I CYCGRG 2 cut(s) 450, 476
BmiI GGNNCC 1 cut(s) 313
BmrFI CCNGG 2 cut(s) 616, 720
BmsI GCATC 2 cut(s) 376, 761
BpuEI CTTGAG 1 cut(s) 12
BpuMI CCSGG 1 cut(s) 616
Bsa29I ATCGAT 1 cut(s) 658
BsaBI GATNNNNATC 1 cut(s) 775
BsaJI CCNNGG 2 cut(s) 319, 615
Bsc4I CCNNNNNNNGG 2 cut(s) 150, 308
Bse21I CCTNAGG 2 cut(s) 263, 391
Bse8I GATNNNNATC 1 cut(s) 775
BseBI CCWGG 1 cut(s) 720
BseCI ATCGAT 1 cut(s) 658
BseDI CCNNGG 2 cut(s) 319, 615
BseGI GGATG 1 cut(s) 776
BseJI GATNNNNATC 1 cut(s) 775
BseLI CCNNNNNNNGG 2 cut(s) 150, 308
BseMII CTCAG 4 cut(s) 254, 360, 405, 671
BseXI GCAGC 1 cut(s) 727
BshFI GGCC 1 cut(s) 459
BshNI GGYRCC 1 cut(s) 311
BshVI ATCGAT 1 cut(s) 658
BsiHKAI GWGCWC 2 cut(s) 28, 529
BsiHKCI CYCGRG 2 cut(s) 450, 476
BsiSI CCGG 1 cut(s) 615
BslI CCNNNNNNNGG 2 cut(s) 150, 308
BsmAI GTCTC 1 cut(s) 676
BsnI GGCC 1 cut(s) 459
BsoBI CYCGRG 2 cut(s) 450, 476
Bsp1286I GDGCHC 2 cut(s) 28, 529
Bsp143I GATC 5 cut(s) 101, 222, 439, 652, 732
BspACI CCGC 1 cut(s) 685
BspANI GGCC 1 cut(s) 459
BspCNI CTCAG 4 cut(s) 255, 359, 404, 672
BspDI ATCGAT 1 cut(s) 658
BspHI TCATGA 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 313
BspPI GGATC 2 cut(s) 109, 740
BspT107I GGYRCC 1 cut(s) 311
BssECI CCNNGG 2 cut(s) 319, 615
BssMI GATC 5 cut(s) 101, 222, 439, 652, 732
BssT1I CCWWGG 1 cut(s) 319
Bst2UI CCWGG 1 cut(s) 720
Bst4CI ACNGT 2 cut(s) 245, 512
Bst6I CTCTTC 1 cut(s) 679
BstC8I GCNNGC 4 cut(s) 337, 430, 545, 633
BstDEI CTNAG 4 cut(s) 263, 346, 391, 680
BstF5I GGATG 1 cut(s) 776
BstKTI GATC 5 cut(s) 104, 225, 442, 655, 735
BstMAI GTCTC 1 cut(s) 676
BstMBI GATC 5 cut(s) 101, 222, 439, 652, 732
BstMWI GCNNNNNNNGC 2 cut(s) 332, 502
BstNI CCWGG 1 cut(s) 720
BstNSI RCATGY 2 cut(s) 139, 339
BstSCI CCNGG 2 cut(s) 614, 718
BstSFI CTRYAG 1 cut(s) 724
BstV1I GCAGC 1 cut(s) 727
BstXI CCANNNNNNTGG 1 cut(s) 290
Bsu15I ATCGAT 1 cut(s) 658
Bsu36I CCTNAGG 2 cut(s) 263, 391
BsuRI GGCC 1 cut(s) 459
BsuTUI ATCGAT 1 cut(s) 658
BtsCI GGATG 1 cut(s) 776
BtsI GCAGTG 1 cut(s) 120
BtsIMutI CAGTG 3 cut(s) 13, 120, 250
Cac8I GCNNGC 4 cut(s) 337, 430, 545, 633
CciI TCATGA 1 cut(s) 61
ClaI ATCGAT 1 cut(s) 658
CseI GACGC 1 cut(s) 636
Csp6I GTAC 1 cut(s) 312
CviAII CATG 7 cut(s) 62, 136, 226, 336, 493, 628, 755
CviQI GTAC 1 cut(s) 312
DdeI CTNAG 4 cut(s) 263, 346, 391, 680
DpnI GATC 5 cut(s) 103, 224, 441, 654, 734
DpnII GATC 5 cut(s) 101, 222, 439, 652, 732
Eam1104I CTCTTC 1 cut(s) 679
EarI CTCTTC 1 cut(s) 679
Eco130I CCWWGG 1 cut(s) 319
Eco147I AGGCCT 1 cut(s) 459
Eco81I CCTNAGG 2 cut(s) 263, 391
Eco88I CYCGRG 2 cut(s) 450, 476
EcoRI GAATTC 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 718
EcoT14I CCWWGG 1 cut(s) 319
EcoT22I ATGCAT 1 cut(s) 643
ErhI CCWWGG 1 cut(s) 319
FaeI CATG 7 cut(s) 65, 139, 229, 339, 496, 631, 758
FatI CATG 7 cut(s) 61, 135, 225, 335, 492, 627, 754
FbaI TGATCA 2 cut(s) 222, 652
Fnu4HI GCNGC 1 cut(s) 716
FokI GGATG 1 cut(s) 783
Fsp4HI GCNGC 1 cut(s) 716
FspBI CTAG 3 cut(s) 116, 461, 555
GluI GCNGC 1 cut(s) 716
HaeIII GGCC 1 cut(s) 459
HapII CCGG 1 cut(s) 615
HgaI GACGC 1 cut(s) 636
Hin1II CATG 7 cut(s) 65, 139, 229, 339, 496, 631, 758
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HpaI GTTAAC 1 cut(s) 241
HpaII CCGG 1 cut(s) 615
HphI GGTGA 3 cut(s) 399, 677, 835
Hpy166II GTNNAC 3 cut(s) 241, 296, 587
Hpy188I TCNGA 5 cut(s) 186, 358, 601, 652, 681
Hpy188III TCNNGA 3 cut(s) 62, 476, 555
Hpy8I GTNNAC 3 cut(s) 241, 296, 587
HpyAV CCTTC 4 cut(s) 157, 242, 325, 356
HpyCH4III ACNGT 2 cut(s) 245, 512
HpyCH4V TGCA 6 cut(s) 125, 236, 335, 339, 641, 754
HpyF10VI GCNNNNNNNGC 2 cut(s) 332, 502
HpyF3I CTNAG 4 cut(s) 263, 346, 391, 680
Hsp92II CATG 7 cut(s) 65, 139, 229, 339, 496, 631, 758
KpnI GGTACC 1 cut(s) 315
Ksp22I TGATCA 2 cut(s) 222, 652
KspAI GTTAAC 1 cut(s) 241
Kzo9I GATC 5 cut(s) 101, 222, 439, 652, 732
LmnI GCTCC 1 cut(s) 552
Lsp1109I GCAGC 1 cut(s) 727
LweI GCATC 2 cut(s) 376, 761
MaeI CTAG 3 cut(s) 116, 461, 555
MaeIII GTNAC 2 cut(s) 484, 706
MalI GATC 5 cut(s) 103, 224, 441, 654, 734
MboI GATC 5 cut(s) 101, 222, 439, 652, 732
MboII GAAGA 3 cut(s) 479, 666, 847
MfeI CAATTG 1 cut(s) 843
MhlI GDGCHC 2 cut(s) 28, 529
MluCI AATT 4 cut(s) 111, 413, 758, 843
MmeI TCCRAC 2 cut(s) 710, 748
Mph1103I ATGCAT 1 cut(s) 643
MseI TTAA 2 cut(s) 240, 741
MspI CCGG 1 cut(s) 615
MspR9I CCNGG 2 cut(s) 616, 720
MunI CAATTG 1 cut(s) 843
MvaI CCWGG 1 cut(s) 720
MwoI GCNNNNNNNGC 2 cut(s) 332, 502
NciI CCSGG 1 cut(s) 616
NdeII GATC 5 cut(s) 101, 222, 439, 652, 732
NlaIII CATG 7 cut(s) 65, 139, 229, 339, 496, 631, 758
NlaIV GGNNCC 1 cut(s) 313
NmuCI GTSAC 1 cut(s) 706
NsiI ATGCAT 1 cut(s) 643
NspI RCATGY 2 cut(s) 139, 339
PaeI GCATGC 1 cut(s) 339
PaeR7I CTCGAG 1 cut(s) 476
PagI TCATGA 1 cut(s) 61
PceI AGGCCT 1 cut(s) 459
PciI ACATGT 1 cut(s) 135
PkrI GCNGC 1 cut(s) 717
PscI ACATGT 1 cut(s) 135
PshBI ATTAAT 1 cut(s) 741
Psp6I CCWGG 1 cut(s) 718
PspGI CCWGG 1 cut(s) 718
PspN4I GGNNCC 1 cut(s) 313
RsaI GTAC 1 cut(s) 313
RsaNI GTAC 1 cut(s) 312
SaqAI TTAA 2 cut(s) 240, 741
SatI GCNGC 1 cut(s) 716
Sau3AI GATC 5 cut(s) 101, 222, 439, 652, 732
ScrFI CCNGG 2 cut(s) 616, 720
SduI GDGCHC 2 cut(s) 28, 529
SfaNI GCATC 2 cut(s) 376, 761
SfcI CTRYAG 1 cut(s) 724
Sfr274I CTCGAG 1 cut(s) 476
SlaI CTCGAG 1 cut(s) 476
SmlI CTYRAG 2 cut(s) 27, 476
SmoI CTYRAG 2 cut(s) 27, 476
SphI GCATGC 1 cut(s) 339
Sse9I AATT 4 cut(s) 111, 413, 758, 843
SseBI AGGCCT 1 cut(s) 459
SsiI CCGC 1 cut(s) 685
SspI AATATT 1 cut(s) 375
SspMI CTAG 3 cut(s) 116, 461, 555
StuI AGGCCT 1 cut(s) 459
StyD4I CCNGG 2 cut(s) 614, 718
StyI CCWWGG 1 cut(s) 319
TaaI ACNGT 2 cut(s) 245, 512
TaqI TCGA 3 cut(s) 194, 477, 658
TasI AATT 4 cut(s) 111, 413, 758, 843
Tru1I TTAA 2 cut(s) 240, 741
Tru9I TTAA 2 cut(s) 240, 741
TscAI CASTG 3 cut(s) 13, 127, 250
TseFI GTSAC 1 cut(s) 706
TseI GCWGC 1 cut(s) 715
Tsp45I GTSAC 1 cut(s) 706
TspDTI ATGAA 6 cut(s) 50, 78, 170, 198, 771, 848
TspRI CASTG 3 cut(s) 13, 127, 250
VspI ATTAAT 1 cut(s) 741
XapI RAATTY 2 cut(s) 111, 758
XbaI TCTAGA 1 cut(s) 554
XceI RCATGY 2 cut(s) 139, 339
XhoI CTCGAG 1 cut(s) 476
XspI CTAG 3 cut(s) 116, 461, 555
Zsp2I ATGCAT 1 cut(s) 643
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.