Rmu_sc0007109.1_g000007

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007109.1
Physical Location & Seq
Forward (+)
27692 .. 28702
1011 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007109.1_g000007.1.cds

Sequence Viewer

Length: 1011 bp
atggatagagaacaagatgagttgcagttccttagtctctttggcatctacagagaatcctacaagattgtatacaaatggagaaaaatcttcagccaaatcaccttgaccttgatcctccctttgagcttcatcttcttggctgacatggaagtctccaacatcctcttcttcaggatcatccacagcgaaagcgccttggacgaaacgagaccagacaccgctcgctacaagagaataagtgacgtcctcaccaaagaaagggcaaccttctggctcttcaaggctgcttacttcacttccatgctcatcttcagcctcctctccacctccgccgtggtgtacaccatcgcatgcgtatacaccgctcgggaaatcaccttccggaagatcatgagtgttgttccaagggtctggaagcgcgtgatgatcaccttcttgtgcaccgtcctggctttcctcctctacaacatagtggcagtagtagtcggaattgtttgcttagctctcttatacagcaacgacggagacggcggcctcgccttcttcataacttttatctttttattgatcttgtacgctattgggttcgtgtacatgaccataatctggcaactggctagcgttgtctcggtgttggaagaaacgaaagggatcaaagccatgatcaagagcaagaagctactcagagggaacatgtgggcggcctcaatcatcttcttcaagatcgttgctttagcctacgttattcagttttcatttcaagcattggttgtggatggatgggtgtttgggataatgggcaggataggcttcggtgttctcttattgttgctgctgcttaagttgattctgtttctgctggtcatccaaacggtgctttacttcgtctgcaaatcttaccaccatgaaaacatcgacaagtcggccctgtcgtatcacctcgaggttatttatctgggagattatgttcctctgaagtctaaggatgttcagctcgagcaggtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

336

Amino Acids

38.68

Weight (kDa)

9.17

Isoelectric Point (pI)

25.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 152
AatII GACGTC 1 cut(s) 249
AbsI CCTCGAGG 1 cut(s) 944
Acc36I ACCTGC 1 cut(s) 994
AccB7I CCANNNNNTGG 1 cut(s) 609
AccBSI CCGCTC 2 cut(s) 224, 368
AccI GTMKAC 2 cut(s) 72, 360
AccII CGCG 1 cut(s) 423
AccIII TCCGGA 1 cut(s) 384
AciI CCGC 5 cut(s) 222, 333, 366, 534, 704
AclWI GGATC 3 cut(s) 109, 185, 662
AcuI CTGAAG 4 cut(s) 76, 157, 298, 998
AcyI GRCGYC 1 cut(s) 246
AfaI GTAC 3 cut(s) 344, 578, 596
AfiI CCNNNNNNNGG 2 cut(s) 261, 609
AflII CTTAAG 1 cut(s) 842
AflIII ACRYGT 1 cut(s) 696
AgsI TTSAA 3 cut(s) 283, 724, 764
AjnI CCWGG 1 cut(s) 450
AjuI GAANNNNNNNTTGG 2 cut(s) 152, 184
AloI GAACNNNNNNTCC 2 cut(s) 954, 986
AluBI AGCT 4 cut(s) 129, 506, 682, 997
AluI AGCT 4 cut(s) 129, 506, 682, 997
Alw21I GWGCWC 1 cut(s) 446
Alw26I GTCTC 5 cut(s) 41, 160, 205, 522, 634
Alw44I GTGCAC 1 cut(s) 442
AlwI GGATC 3 cut(s) 109, 185, 662
Ama87I CYCGRG 3 cut(s) 369, 944, 998
Aor13HI TCCGGA 1 cut(s) 384
AoxI GGCC 3 cut(s) 535, 705, 927
ApaLI GTGCAC 1 cut(s) 442
ApeKI GCWGC 3 cut(s) 287, 835, 838
AspLEI GCGC 2 cut(s) 197, 423
AspS9I GGNCC 1 cut(s) 928
AsuHPI GGTGA 5 cut(s) 94, 244, 370, 424, 932
AsuNHI GCTAGC 1 cut(s) 620
AvaI CYCGRG 3 cut(s) 369, 944, 998
BaeGI GKGCMC 1 cut(s) 446
Bbv12I GWGCWC 1 cut(s) 446
BbvI GCAGC 3 cut(s) 274, 822, 825
BccI CCATC 3 cut(s) 356, 773, 777
BceAI ACGGC 2 cut(s) 320, 547
BciT130I CCWGG 1 cut(s) 452
BclI TGATCA 2 cut(s) 429, 666
BcoDI GTCTC 5 cut(s) 41, 160, 205, 522, 634
BfaI CTAG 1 cut(s) 621
BfmI CTRYAG 1 cut(s) 49
BfoI RGCGCY 1 cut(s) 198
BfrI CTTAAG 1 cut(s) 842
BfuAI ACCTGC 1 cut(s) 994
BisI GCNGC 5 cut(s) 288, 535, 705, 836, 839
BlpI GCTNAGC 1 cut(s) 502
BlsI GCNGC 5 cut(s) 289, 536, 706, 837, 840
Bme1390I CCNGG 1 cut(s) 452
BmeT110I CYCGRG 3 cut(s) 369, 944, 998
BmgT120I GGNCC 1 cut(s) 928
BmrFI CCNGG 1 cut(s) 452
BmsI GCATC 1 cut(s) 54
BmtI GCTAGC 1 cut(s) 624
Bpu1102I GCTNAGC 1 cut(s) 502
BsaHI GRCGYC 1 cut(s) 246
BsaI GGTCTC 1 cut(s) 205
BsaJI CCNNGG 3 cut(s) 198, 336, 407
BsaWI WCCGGW 1 cut(s) 384
BsaXI ACNNNNNCTCC 2 cut(s) 954, 984
Bsc4I CCNNNNNNNGG 2 cut(s) 261, 609
Bse1I ACTGG 1 cut(s) 621
BseAI TCCGGA 1 cut(s) 384
BseBI CCWGG 1 cut(s) 452
BseDI CCNNGG 3 cut(s) 198, 336, 407
BseGI GGATG 6 cut(s) 162, 180, 784, 788, 867, 994
BseLI CCNNNNNNNGG 2 cut(s) 261, 609
BseMII CTCAG 1 cut(s) 700
BseNI ACTGG 1 cut(s) 621
BseRI GAGGAG 2 cut(s) 311, 452
BseSI GKGCMC 1 cut(s) 446
BseXI GCAGC 3 cut(s) 274, 822, 825
Bsh1236I CGCG 1 cut(s) 423
BshFI GGCC 3 cut(s) 537, 707, 929
BsiHKAI GWGCWC 1 cut(s) 446
BsiHKCI CYCGRG 3 cut(s) 369, 944, 998
BsiSI CCGG 1 cut(s) 385
BslI CCNNNNNNNGG 2 cut(s) 261, 609
BsmAI GTCTC 5 cut(s) 41, 160, 205, 522, 634
BsmBI CGTCTC 1 cut(s) 522
BsnI GGCC 3 cut(s) 537, 707, 929
Bso31I GGTCTC 1 cut(s) 205
BsoBI CYCGRG 3 cut(s) 369, 944, 998
Bsp1286I GDGCHC 1 cut(s) 446
Bsp13I TCCGGA 1 cut(s) 384
Bsp1407I TGTACA 2 cut(s) 342, 594
Bsp143I GATC 8 cut(s) 114, 177, 390, 429, 570, 654, 666, 726
Bsp1720I GCTNAGC 1 cut(s) 502
BspACI CCGC 5 cut(s) 222, 333, 366, 534, 704
BspANI GGCC 3 cut(s) 537, 707, 929
BspCNI CTCAG 1 cut(s) 699
BspEI TCCGGA 1 cut(s) 384
BspFNI CGCG 1 cut(s) 423
BspHI TCATGA 1 cut(s) 393
BspMI ACCTGC 1 cut(s) 994
BspOI GCTAGC 1 cut(s) 624
BspPI GGATC 3 cut(s) 109, 185, 662
BspQI GCTCTTC 1 cut(s) 284
BspTI CTTAAG 1 cut(s) 842
BspTNI GGTCTC 1 cut(s) 205
BsrBI CCGCTC 2 cut(s) 224, 368
BsrGI TGTACA 2 cut(s) 342, 594
BsrI ACTGG 1 cut(s) 621
BssECI CCNNGG 3 cut(s) 198, 336, 407
BssMI GATC 8 cut(s) 114, 177, 390, 429, 570, 654, 666, 726
BssNAI GTATAC 2 cut(s) 73, 361
BssNI GRCGYC 1 cut(s) 246
BssT1I CCWWGG 2 cut(s) 198, 407
Bst1107I GTATAC 2 cut(s) 73, 361
Bst2UI CCWGG 1 cut(s) 452
Bst4CI ACNGT 2 cut(s) 448, 877
Bst6I CTCTTC 2 cut(s) 173, 284
BstACI GRCGYC 1 cut(s) 246
BstAFI CTTAAG 1 cut(s) 842
BstAUI TGTACA 2 cut(s) 342, 594
BstC8I GCNNGC 3 cut(s) 226, 355, 622
BstDEI CTNAG 4 cut(s) 32, 502, 686, 984
BstDSI CCRYGG 1 cut(s) 336
BstF5I GGATG 6 cut(s) 162, 180, 784, 788, 867, 994
BstFNI CGCG 1 cut(s) 423
BstH2I RGCGCY 1 cut(s) 198
BstHHI GCGC 2 cut(s) 197, 423
BstKTI GATC 8 cut(s) 117, 180, 393, 432, 573, 657, 669, 729
BstMAI GTCTC 5 cut(s) 41, 160, 205, 522, 634
BstMBI GATC 8 cut(s) 114, 177, 390, 429, 570, 654, 666, 726
BstMWI GCNNNNNNNGC 1 cut(s) 810
BstNI CCWGG 1 cut(s) 452
BstNSI RCATGY 2 cut(s) 357, 700
BstSCI CCNGG 1 cut(s) 450
BstSFI CTRYAG 1 cut(s) 49
BstSLI GKGCMC 1 cut(s) 446
BstUI CGCG 1 cut(s) 423
BstV1I GCAGC 3 cut(s) 274, 822, 825
BstXI CCANNNNNNTGG 1 cut(s) 414
BstZ17I GTATAC 2 cut(s) 73, 361
BsuRI GGCC 3 cut(s) 537, 707, 929
BtgI CCRYGG 1 cut(s) 336
BtgZI GCGATG 1 cut(s) 334
BtsCI GGATG 6 cut(s) 162, 180, 784, 788, 867, 994
BveI ACCTGC 1 cut(s) 994
Cac8I GCNNGC 3 cut(s) 226, 355, 622
CciI TCATGA 1 cut(s) 393
CfoI GCGC 2 cut(s) 197, 423
Cfr13I GGNCC 1 cut(s) 928
Csp6I GTAC 3 cut(s) 343, 577, 595
CviAII CATG 8 cut(s) 148, 304, 354, 394, 598, 664, 697, 908
CviQI GTAC 3 cut(s) 343, 577, 595
DdeI CTNAG 4 cut(s) 32, 502, 686, 984
DpnI GATC 8 cut(s) 116, 179, 392, 431, 572, 656, 668, 728
DpnII GATC 8 cut(s) 114, 177, 390, 429, 570, 654, 666, 726
DrdI GACNNNNNNGTC 1 cut(s) 152
DseDI GACNNNNNNGTC 1 cut(s) 152
Eam1104I CTCTTC 2 cut(s) 173, 284
EarI CTCTTC 2 cut(s) 173, 284
EciI GGCGGA 1 cut(s) 322
Eco130I CCWWGG 2 cut(s) 198, 407
Eco31I GGTCTC 1 cut(s) 205
Eco57I CTGAAG 4 cut(s) 76, 157, 298, 998
Eco88I CYCGRG 3 cut(s) 369, 944, 998
EcoRII CCWGG 1 cut(s) 450
EcoT14I CCWWGG 2 cut(s) 198, 407
ErhI CCWWGG 2 cut(s) 198, 407
Esp3I CGTCTC 1 cut(s) 522
FaeI CATG 8 cut(s) 151, 307, 357, 397, 601, 667, 700, 911
FatI CATG 8 cut(s) 147, 303, 353, 393, 597, 663, 696, 907
FbaI TGATCA 2 cut(s) 429, 666
FblI GTMKAC 2 cut(s) 72, 360
Fnu4HI GCNGC 5 cut(s) 288, 535, 705, 836, 839
FokI GGATG 6 cut(s) 149, 167, 791, 795, 854, 1001
Fsp4HI GCNGC 5 cut(s) 288, 535, 705, 836, 839
FspBI CTAG 1 cut(s) 621
GlaI GCGC 2 cut(s) 196, 422
GluI GCNGC 5 cut(s) 288, 535, 705, 836, 839
HaeII RGCGCY 1 cut(s) 198
HaeIII GGCC 3 cut(s) 537, 707, 929
HapII CCGG 1 cut(s) 385
HhaI GCGC 2 cut(s) 197, 423
Hin1I GRCGYC 1 cut(s) 246
Hin1II CATG 8 cut(s) 151, 307, 357, 397, 601, 667, 700, 911
Hin6I GCGC 2 cut(s) 195, 421
HinP1I GCGC 2 cut(s) 195, 421
HinfI GANTC 2 cut(s) 56, 850
HpaII CCGG 1 cut(s) 385
HphI GGTGA 5 cut(s) 94, 244, 370, 424, 932
Hpy166II GTNNAC 6 cut(s) 73, 343, 345, 361, 444, 595
Hpy188I TCNGA 3 cut(s) 491, 689, 978
Hpy188III TCNNGA 7 cut(s) 175, 371, 385, 394, 415, 670, 724
Hpy8I GTNNAC 6 cut(s) 73, 343, 345, 361, 444, 595
Hpy99I CGWCG 1 cut(s) 527
HpyAV CCTTC 4 cut(s) 280, 391, 445, 553
HpyCH4III ACNGT 2 cut(s) 448, 877
HpyCH4IV ACGT 2 cut(s) 246, 744
HpyCH4V TGCA 3 cut(s) 25, 444, 894
HpyF10VI GCNNNNNNNGC 1 cut(s) 810
HpyF3I CTNAG 4 cut(s) 32, 502, 686, 984
HpySE526I ACGT 2 cut(s) 246, 744
Hsp92I GRCGYC 1 cut(s) 246
Hsp92II CATG 8 cut(s) 151, 307, 357, 397, 601, 667, 700, 911
HspAI GCGC 2 cut(s) 195, 421
Kpn2I TCCGGA 1 cut(s) 384
Ksp22I TGATCA 2 cut(s) 429, 666
Kzo9I GATC 8 cut(s) 114, 177, 390, 429, 570, 654, 666, 726
LguI GCTCTTC 1 cut(s) 284
Lsp1109I GCAGC 3 cut(s) 274, 822, 825
LweI GCATC 1 cut(s) 54
MaeI CTAG 1 cut(s) 621
MaeII ACGT 2 cut(s) 246, 744
MaeIII GTNAC 1 cut(s) 242
MalI GATC 8 cut(s) 116, 179, 392, 431, 572, 656, 668, 728
MbiI CCGCTC 2 cut(s) 224, 368
MboI GATC 8 cut(s) 114, 177, 390, 429, 570, 654, 666, 726
MhlI GDGCHC 1 cut(s) 446
MluCI AATT 1 cut(s) 492
MmeI TCCRAC 3 cut(s) 183, 469, 618
MroI TCCGGA 1 cut(s) 384
MseI TTAA 2 cut(s) 843, 1009
MslI CAYNNNNRTG 1 cut(s) 302
MspCI CTTAAG 1 cut(s) 842
MspI CCGG 1 cut(s) 385
MspR9I CCNGG 1 cut(s) 452
MvaI CCWGG 1 cut(s) 452
MvnI CGCG 1 cut(s) 423
MwoI GCNNNNNNNGC 1 cut(s) 810
NdeII GATC 8 cut(s) 114, 177, 390, 429, 570, 654, 666, 726
NheI GCTAGC 1 cut(s) 620
NlaIII CATG 8 cut(s) 151, 307, 357, 397, 601, 667, 700, 911
NmuCI GTSAC 1 cut(s) 242
NspI RCATGY 2 cut(s) 357, 700
PaeI GCATGC 1 cut(s) 357
PaeR7I CTCGAG 2 cut(s) 944, 998
PagI TCATGA 1 cut(s) 393
PciI ACATGT 1 cut(s) 696
PciSI GCTCTTC 1 cut(s) 284
PcsI WCGNNNNNNNCGW 1 cut(s) 932
PfeI GAWTC 2 cut(s) 56, 850
PflMI CCANNNNNTGG 1 cut(s) 609
PkrI GCNGC 5 cut(s) 289, 536, 706, 837, 840
PscI ACATGT 1 cut(s) 696
Psp6I CCWGG 1 cut(s) 450
PspGI CCWGG 1 cut(s) 450
PspPI GGNCC 1 cut(s) 928
PspXI VCTCGAGB 2 cut(s) 944, 998
RsaI GTAC 3 cut(s) 344, 578, 596
RsaNI GTAC 3 cut(s) 343, 577, 595
RseI CAYNNNNRTG 1 cut(s) 302
SapI GCTCTTC 1 cut(s) 284
SaqAI TTAA 2 cut(s) 843, 1009
SatI GCNGC 5 cut(s) 288, 535, 705, 836, 839
Sau3AI GATC 8 cut(s) 114, 177, 390, 429, 570, 654, 666, 726
Sau96I GGNCC 1 cut(s) 928
ScrFI CCNGG 1 cut(s) 452
SduI GDGCHC 1 cut(s) 446
SfaNI GCATC 1 cut(s) 54
SfcI CTRYAG 1 cut(s) 49
Sfr274I CTCGAG 2 cut(s) 944, 998
SlaI CTCGAG 2 cut(s) 944, 998
SmiMI CAYNNNNRTG 1 cut(s) 302
SmlI CTYRAG 3 cut(s) 842, 944, 998
SmoI CTYRAG 3 cut(s) 842, 944, 998
SphI GCATGC 1 cut(s) 357
Sse9I AATT 1 cut(s) 492
SsiI CCGC 5 cut(s) 222, 333, 366, 534, 704
SspMI CTAG 1 cut(s) 621
StyD4I CCNGG 1 cut(s) 450
StyI CCWWGG 2 cut(s) 198, 407
TaaI ACNGT 2 cut(s) 448, 877
TaiI ACGT 2 cut(s) 249, 747
TaqI TCGA 3 cut(s) 918, 945, 999
TasI AATT 1 cut(s) 492
TatI WGTACW 2 cut(s) 342, 594
TauI GCSGC 2 cut(s) 537, 707
TfiI GAWTC 2 cut(s) 56, 850
Tru1I TTAA 2 cut(s) 843, 1009
Tru9I TTAA 2 cut(s) 843, 1009
TseFI GTSAC 1 cut(s) 242
TseI GCWGC 3 cut(s) 287, 835, 838
Tsp45I GTSAC 1 cut(s) 242
TspDTI ATGAA 4 cut(s) 121, 538, 747, 924
TspGWI ACGGA 1 cut(s) 540
Van91I CCANNNNNTGG 1 cut(s) 609
Vha464I CTTAAG 1 cut(s) 842
VneI GTGCAC 1 cut(s) 442
XceI RCATGY 2 cut(s) 357, 700
XcmI CCANNNNNNNNNTGG 1 cut(s) 334
XhoI CTCGAG 2 cut(s) 944, 998
XmiI GTMKAC 2 cut(s) 72, 360
XspI CTAG 1 cut(s) 621
ZraI GACGTC 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.