Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008401.1

Orthogroup ID

OG0005977

Physical Location & Seq

Genomic Coordinates Forward (+)

7 .. 3762

Gene Structure 3756 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008401.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1425 bp

atggacgcgctcgggctggttttgcagctggcgaaagcaccactgatcgtgccgctgttgcgagttttggtggcggtgtgcttggggatgtctgtgttgctctttgtggagaaggtgtacatgggaattgtcataatgttggtcaaggttttcagaagaagacctgagaagcgttggaaatgggaggcaattaaggatgatgtggagcttggcaattctgcttaccctatggttcttgtgcaaattccaatgtacaatgaaaaagaggtttatcaactttctatcggggctgcatgtgggctttcatggccttctgataggatcgtagttcaagttcttgatgattcaactgacccactcattaaggatttggtggaagtagaagtgcagagatgggcaagcaaaggaataaacataaagtacgaggtcagagacaacagaaaagggtacaaagcaggggctctcaaagagggaatgaagcactcttacgccaaacagtgtgactacgttgccatttttgatgccgacttccaacctgagtccgattttctgtggcgcacaatcccatttctcctccacaaccctgacattgctcttgtccaagctcgctggaaatatgtaaatgctgatgagtgcctgatgaccagaatgcaagagatgtctctagattaccatttcacagtggagcaggaagttgggtctgcgactcatgccttctttggtttcaatggcacagctggagtgtggagaatcacggccctcaatgaggctggaggatggaaggaccgcacaacagtggaggatatggatttagctgtacgagctagtcttagaggctggaagttcgtctatatttctgacctcaaggtgaaaaatgaattgcccagtactttcaaagcctaccgttatcagcagcaccgatggtcttgtggtccggctaatctcttccggaagatggtaatggagattttaagaaacaagaaggtgtccccattgaagaagtttcatgtgatctacagcttcttctttgttcgcaaaatcgtagcgcatattgtcacctttgtcttctactgtgttattttaccaacaacggttttggttcctgaagtacaagttcccatttggggtgctgtatacattccttctaccattactctcctcaatgcagttggaactcctagatcactccacctattgattttctggattctctttgagaatgtaatgtccctgcaccggactaaggcaacatttataggcctgtttgaagcagggagagtaaacgaatgggtcgtcaccgagaaattgggagatgctctcaagacaaaatcagctgcaaaagctcacaggaaacctcgactaaggattggagaaaggtatagttattttgccggtcattcctgtcctgttttctggaaaatataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Glyco_tranf_2_3 Glyco_trans_2_3

Protein Analysis

474

Amino Acids

54.44

Weight (kDa)

9.38

Isoelectric Point (pI)

37.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005977)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G23480 AT1G23480 AT1G23480 AT1G23480 AT2G35650 AT2G35650 AT2G35650 AT5G16190
fragaria_vesca	FvH4_7g06310
malus_domestica	MD02G1245000.v1.1 MD07G1071900.v1.1
prunus_persica	Prupe.2G089900_v2.0.a1 Prupe.2G089900_v2.0.a1 Prupe.2G090000_v2.0.a1
pyrus_communis	pycom07g05480
rosa_chinensis	RchiOBHm_Chr1g0334161
rosa_laevigata	RLG00000029475
rosa_multiflora	Rmu_sc0003690.1_g000039 Rmu_sc0008401.1_g000001
rosa_roxburghii	Rroxscaffold_4G00316980
rosa_rugosa	Rorug01G0113000
rosa_samantha	Rh1AG137000 Rh1BG104400 Rh1CG129200
rosa_wichuraiana	Rw0G019290 Rw0G020510 Rw1G011390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	1134
AccII	CGCG	1 cut(s)	8
AccIII	TCCGGA	1 cut(s)	948
AciI	CCGC	3 cut(s)	53, 74, 787
AclWI	GGATC	1 cut(s)	329
AcsI	RAATTY	1 cut(s)	243
AcuI	CTGAAG	1 cut(s)	1125
AfaI	GTAC	7 cut(s)	119, 254, 422, 449, 819, 889, 1110
AfiI	CCNNNNNNNGG	5 cut(s)	766, 955, 1124, 1236, 1243
AgsI	TTSAA	6 cut(s)	332, 348, 727, 895, 997, 1268
AleI	CACNNNNGTG	1 cut(s)	794
AluBI	AGCT	9 cut(s)	28, 208, 605, 737, 815, 824, 1020, 1334, 1343
AluI	AGCT	9 cut(s)	28, 208, 605, 737, 815, 824, 1020, 1334, 1343
Alw26I	GTCTC	2 cut(s)	426, 666
AlwI	GGATC	1 cut(s)	329
Ama87I	CYCGRG	1 cut(s)	11
Aor13HI	TCCGGA	1 cut(s)	948
AoxI	GGCC	3 cut(s)	308, 756, 1258
ApeKI	GCWGC	4 cut(s)	25, 290, 913, 1334
ApoI	RAATTY	1 cut(s)	243
ArsI	GACNNNNNNTTYG	2 cut(s)	1278, 1310
AspLEI	GCGC	3 cut(s)	10, 558, 1048
AspS9I	GGNCC	3 cut(s)	757, 784, 932
AsuHPI	GGTGA	3 cut(s)	880, 1048, 1288
AvaI	CYCGRG	1 cut(s)	11
AvaII	GGWCC	2 cut(s)	784, 932
BanII	GRGCYC	1 cut(s)	463
BarI	GAAGNNNNNNTAC	2 cut(s)	470, 502
BbsI	GAAGAC	2 cut(s)	166, 1057
BbvI	GCAGC	4 cut(s)	37, 277, 925, 1321
BccI	CCATC	4 cut(s)	387, 771, 915, 949
BceAI	ACGGC	1 cut(s)	771
BcoDI	GTCTC	2 cut(s)	426, 666
BfaI	CTAG	3 cut(s)	665, 825, 1179
BfmI	CTRYAG	1 cut(s)	1015
BisI	GCNGC	5 cut(s)	26, 53, 291, 914, 1335
BlsI	GCNGC	5 cut(s)	27, 54, 292, 915, 1336
BmcAI	AGTACT	1 cut(s)	889
Bme18I	GGWCC	2 cut(s)	784, 932
BmeT110I	CYCGRG	1 cut(s)	11
BmgT120I	GGNCC	3 cut(s)	757, 784, 932
BmiI	GGNNCC	1 cut(s)	1101
BmrI	ACTGGG	1 cut(s)	879
BmsI	GCATC	2 cut(s)	511, 1303
BmuI	ACTGGG	1 cut(s)	879
BpiI	GAAGAC	2 cut(s)	166, 1057
BplI	GAGNNNNNCTC	2 cut(s)	1302, 1334
BpmI	CTGGAG	2 cut(s)	759, 792
BpuEI	CTTGAG	2 cut(s)	848, 1304
BsaWI	WCCGGW	2 cut(s)	948, 1236
BsaXI	ACNNNNNCTCC	2 cut(s)	101, 131
Bsc4I	CCNNNNNNNGG	5 cut(s)	766, 955, 1124, 1236, 1243
Bse118I	RCCGGY	1 cut(s)	1391
Bse1I	ACTGG	1 cut(s)	885
Bse3DI	GCAATG	1 cut(s)	588
BseAI	TCCGGA	1 cut(s)	948
BseGI	GGATG	3 cut(s)	93, 202, 782
BseLI	CCNNNNNNNGG	5 cut(s)	766, 955, 1124, 1236, 1243
BseMI	GCAATG	1 cut(s)	588
BseMII	CTCAG	2 cut(s)	156, 528
BseNI	ACTGG	1 cut(s)	885
BseRI	GAGGAG	2 cut(s)	563, 1148
BseXI	GCAGC	4 cut(s)	37, 277, 925, 1321
BsgI	GTGCAG	2 cut(s)	407, 1217
Bsh1236I	CGCG	1 cut(s)	8
BshFI	GGCC	3 cut(s)	310, 758, 1260
BsiHKCI	CYCGRG	1 cut(s)	11
BsiSI	CCGG	4 cut(s)	935, 949, 1237, 1392
BslFI	GGGAC	2 cut(s)	973, 1213
BslI	CCNNNNNNNGG	5 cut(s)	766, 955, 1124, 1236, 1243
BsmAI	GTCTC	2 cut(s)	426, 666
BsmFI	GGGAC	2 cut(s)	973, 1213
BsmI	GAATGC	1 cut(s)	654
BsnI	GGCC	3 cut(s)	310, 758, 1260
BsoBI	CYCGRG	1 cut(s)	11
Bsp1286I	GDGCHC	1 cut(s)	463
Bsp13I	TCCGGA	1 cut(s)	948
Bsp1407I	TGTACA	2 cut(s)	117, 252
Bsp143I	GATC	4 cut(s)	45, 321, 1011, 1181
BspACI	CCGC	3 cut(s)	53, 74, 787
BspANI	GGCC	3 cut(s)	310, 758, 1260
BspCNI	CTCAG	2 cut(s)	157, 529
BspEI	TCCGGA	1 cut(s)	948
BspFNI	CGCG	1 cut(s)	8
BspLI	GGNNCC	1 cut(s)	1101
BspPI	GGATC	1 cut(s)	329
BsrDI	GCAATG	1 cut(s)	588
BsrFI	RCCGGY	1 cut(s)	1391
BsrGI	TGTACA	2 cut(s)	117, 252
BsrI	ACTGG	1 cut(s)	885
BssAI	RCCGGY	1 cut(s)	1391
BssMI	GATC	4 cut(s)	45, 321, 1011, 1181
BssNAI	GTATAC	1 cut(s)	1135
Bst1107I	GTATAC	1 cut(s)	1135
Bst4CI	ACNGT	6 cut(s)	498, 682, 796, 905, 1073, 1093
Bst6I	CTCTTC	1 cut(s)	950
BstAUI	TGTACA	2 cut(s)	117, 252
BstC8I	GCNNGC	3 cut(s)	30, 400, 607
BstDEI	CTNAG	5 cut(s)	165, 537, 830, 1242, 1361
BstENI	CCTNNNNNAGG	1 cut(s)	764
BstF5I	GGATG	3 cut(s)	93, 202, 782
BstFNI	CGCG	1 cut(s)	8
BstHHI	GCGC	3 cut(s)	10, 558, 1048
BstKTI	GATC	4 cut(s)	48, 324, 1014, 1184
BstMAI	GTCTC	2 cut(s)	426, 666
BstMBI	GATC	4 cut(s)	45, 321, 1011, 1181
BstMWI	GCNNNNNNNGC	6 cut(s)	22, 58, 307, 710, 821, 1340
BstNSI	RCATGY	1 cut(s)	297
BstSFI	CTRYAG	1 cut(s)	1015
BstUI	CGCG	1 cut(s)	8
BstV1I	GCAGC	4 cut(s)	37, 277, 925, 1321
BstV2I	GAAGAC	2 cut(s)	166, 1057
BstZ17I	GTATAC	1 cut(s)	1135
BsuRI	GGCC	3 cut(s)	310, 758, 1260
BtsCI	GGATG	3 cut(s)	93, 202, 782
BtsIMutI	CAGTG	4 cut(s)	41, 503, 687, 801
Cac8I	GCNNGC	3 cut(s)	30, 400, 607
CfoI	GCGC	3 cut(s)	10, 558, 1048
Cfr10I	RCCGGY	1 cut(s)	1391
Cfr13I	GGNCC	3 cut(s)	757, 784, 932
CseI	GACGC	1 cut(s)	14
Csp6I	GTAC	7 cut(s)	118, 253, 421, 448, 818, 888, 1109
CviAII	CATG	5 cut(s)	121, 294, 306, 710, 1007
CviQI	GTAC	7 cut(s)	118, 253, 421, 448, 818, 888, 1109
DdeI	CTNAG	5 cut(s)	165, 537, 830, 1242, 1361
DpnI	GATC	4 cut(s)	47, 323, 1013, 1183
DpnII	GATC	4 cut(s)	45, 321, 1011, 1181
Eam1104I	CTCTTC	1 cut(s)	950
EarI	CTCTTC	1 cut(s)	950
Eco147I	AGGCCT	1 cut(s)	1260
Eco24I	GRGCYC	1 cut(s)	463
Eco47I	GGWCC	2 cut(s)	784, 932
Eco57I	CTGAAG	1 cut(s)	1125
Eco88I	CYCGRG	1 cut(s)	11
EcoNI	CCTNNNNNAGG	1 cut(s)	764
EcoT38I	GRGCYC	1 cut(s)	463
FaeI	CATG	5 cut(s)	124, 297, 309, 713, 1010
FaqI	GGGAC	2 cut(s)	973, 1213
FatI	CATG	5 cut(s)	120, 293, 305, 709, 1006
FblI	GTMKAC	1 cut(s)	1134
Fnu4HI	GCNGC	5 cut(s)	26, 53, 291, 914, 1335
FokI	GGATG	3 cut(s)	100, 209, 789
FriOI	GRGCYC	1 cut(s)	463
Fsp4HI	GCNGC	5 cut(s)	26, 53, 291, 914, 1335
FspBI	CTAG	3 cut(s)	665, 825, 1179
GlaI	GCGC	3 cut(s)	9, 557, 1047
GluI	GCNGC	5 cut(s)	26, 53, 291, 914, 1335
GsuI	CTGGAG	2 cut(s)	759, 792
HaeIII	GGCC	3 cut(s)	310, 758, 1260
HapII	CCGG	4 cut(s)	935, 949, 1237, 1392
HgaI	GACGC	1 cut(s)	14
HhaI	GCGC	3 cut(s)	10, 558, 1048
Hin1II	CATG	5 cut(s)	124, 297, 309, 713, 1010
Hin6I	GCGC	3 cut(s)	8, 556, 1046
HinP1I	GCGC	3 cut(s)	8, 556, 1046
HinfI	GANTC	5 cut(s)	344, 539, 706, 750, 1207
HpaII	CCGG	4 cut(s)	935, 949, 1237, 1392
HphI	GGTGA	3 cut(s)	880, 1048, 1288
Hpy166II	GTNNAC	3 cut(s)	118, 1135, 1282
Hpy188I	TCNGA	5 cut(s)	155, 316, 431, 544, 859
Hpy188III	TCNNGA	7 cut(s)	338, 665, 949, 1103, 1204, 1321, 1414
Hpy8I	GTNNAC	3 cut(s)	118, 1135, 1282
HpyAV	CCTTC	6 cut(s)	106, 321, 724, 775, 976, 1152
HpyCH4III	ACNGT	6 cut(s)	498, 682, 796, 905, 1073, 1093
HpyCH4IV	ACGT	1 cut(s)	507
HpyCH4V	TGCA	8 cut(s)	25, 241, 293, 388, 652, 1166, 1234, 1337
HpyF10VI	GCNNNNNNNGC	6 cut(s)	22, 58, 307, 710, 821, 1340
HpyF3I	CTNAG	5 cut(s)	165, 537, 830, 1242, 1361
HpySE526I	ACGT	1 cut(s)	507
Hsp92II	CATG	5 cut(s)	124, 297, 309, 713, 1010
HspAI	GCGC	3 cut(s)	8, 556, 1046
Kpn2I	TCCGGA	1 cut(s)	948
Kzo9I	GATC	4 cut(s)	45, 321, 1011, 1181
LmnI	GCTCC	2 cut(s)	205, 685
Lsp1109I	GCAGC	4 cut(s)	37, 277, 925, 1321
LweI	GCATC	2 cut(s)	511, 1303
MaeI	CTAG	3 cut(s)	665, 825, 1179
MaeII	ACGT	1 cut(s)	507
MaeIII	GTNAC	3 cut(s)	500, 1054, 1294
MalI	GATC	4 cut(s)	47, 323, 1013, 1183
MboI	GATC	4 cut(s)	45, 321, 1011, 1181
MboII	GAAGA	7 cut(s)	168, 171, 937, 964, 1009, 1015, 1057
MhlI	GDGCHC	1 cut(s)	463
MluCI	AATT	6 cut(s)	126, 189, 214, 243, 878, 1304
MlyI	GAGTC	2 cut(s)	548, 700
MmeI	TCCRAC	3 cut(s)	155, 556, 1150
MroI	TCCGGA	1 cut(s)	948
MseI	TTAA	3 cut(s)	192, 363, 971
MslI	CAYNNNNRTG	1 cut(s)	794
MspA1I	CMGCKG	4 cut(s)	28, 55, 737, 1334
MspI	CCGG	4 cut(s)	935, 949, 1237, 1392
Mva1269I	GAATGC	1 cut(s)	654
MvnI	CGCG	1 cut(s)	8
MwoI	GCNNNNNNNGC	6 cut(s)	22, 58, 307, 710, 821, 1340
NdeII	GATC	4 cut(s)	45, 321, 1011, 1181
NlaIII	CATG	5 cut(s)	124, 297, 309, 713, 1010
NlaIV	GGNNCC	1 cut(s)	1101
NmuCI	GTSAC	3 cut(s)	500, 1054, 1294
NspI	RCATGY	1 cut(s)	297
OliI	CACNNNNGTG	1 cut(s)	794
PceI	AGGCCT	1 cut(s)	1260
PcsI	WCGNNNNNNNCGW	1 cut(s)	1290
PctI	GAATGC	1 cut(s)	654
PfeI	GAWTC	3 cut(s)	344, 750, 1207
PkrI	GCNGC	5 cut(s)	27, 54, 292, 915, 1336
PleI	GAGTC	2 cut(s)	547, 700
PpsI	GAGTC	2 cut(s)	547, 700
PspN4I	GGNNCC	1 cut(s)	1101
PspPI	GGNCC	3 cut(s)	757, 784, 932
PsrI	GAACNNNNNNTAC	2 cut(s)	318, 350
PvuII	CAGCTG	3 cut(s)	28, 737, 1334
RsaI	GTAC	7 cut(s)	119, 254, 422, 449, 819, 889, 1110
RsaNI	GTAC	7 cut(s)	118, 253, 421, 448, 818, 888, 1109
RseI	CAYNNNNRTG	1 cut(s)	794
SaqAI	TTAA	3 cut(s)	192, 363, 971
SatI	GCNGC	5 cut(s)	26, 53, 291, 914, 1335
Sau3AI	GATC	4 cut(s)	45, 321, 1011, 1181
Sau96I	GGNCC	3 cut(s)	757, 784, 932
ScaI	AGTACT	1 cut(s)	889
SchI	GAGTC	2 cut(s)	548, 700
SduI	GDGCHC	1 cut(s)	463
SfaNI	GCATC	2 cut(s)	511, 1303
SfcI	CTRYAG	1 cut(s)	1015
SinI	GGWCC	2 cut(s)	784, 932
SmiMI	CAYNNNNRTG	1 cut(s)	794
SmlI	CTYRAG	2 cut(s)	863, 1319
SmoI	CTYRAG	2 cut(s)	863, 1319
Sse9I	AATT	6 cut(s)	126, 189, 214, 243, 878, 1304
SseBI	AGGCCT	1 cut(s)	1260
SsiI	CCGC	3 cut(s)	53, 74, 787
SspMI	CTAG	3 cut(s)	665, 825, 1179
StuI	AGGCCT	1 cut(s)	1260
TaaI	ACNGT	6 cut(s)	498, 682, 796, 905, 1073, 1093
TaiI	ACGT	1 cut(s)	510
TaqI	TCGA	1 cut(s)	1357
TasI	AATT	6 cut(s)	126, 189, 214, 243, 878, 1304
TatI	WGTACW	4 cut(s)	117, 252, 887, 1108
TauI	GCSGC	1 cut(s)	55
TfiI	GAWTC	3 cut(s)	344, 750, 1207
Tru1I	TTAA	3 cut(s)	192, 363, 971
Tru9I	TTAA	3 cut(s)	192, 363, 971
TscAI	CASTG	4 cut(s)	48, 503, 687, 801
TseFI	GTSAC	3 cut(s)	500, 1054, 1294
TseI	GCWGC	4 cut(s)	25, 290, 913, 1334
Tsp45I	GTSAC	3 cut(s)	500, 1054, 1294
TspDTI	ATGAA	5 cut(s)	273, 294, 491, 891, 995
TspRI	CASTG	4 cut(s)	48, 503, 687, 801
VpaK11BI	GGWCC	2 cut(s)	784, 932
XagI	CCTNNNNNAGG	1 cut(s)	764
XapI	RAATTY	1 cut(s)	243
XbaI	TCTAGA	1 cut(s)	664
XceI	RCATGY	1 cut(s)	297
XmiI	GTMKAC	1 cut(s)	1134
XspI	CTAG	3 cut(s)	665, 825, 1179
ZrmI	AGTACT	1 cut(s)	889

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.