Rmu_sc0008647.1_g000017

Haloacid dehalogenase-like hydrolase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008647.1
OG0007953
Physical Location & Seq
Forward (+)
77302 .. 78340
1039 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008647.1_g000017.1.cds

Sequence Viewer

Length: 564 bp
atgacttggagtgctcgtggtgccatatctcttgagggccttggattacaagttgtgggaaatgttcaagatgctgactttattttggcccatggcactgaagccttggggaatccttcaggtgatgcaattcccatgaaactggaggaacttgagaatatattggaacaatgtgctgctaaggacattcctatggtggtggccaatcctgattttgtgactgttgaggctagagctttgcgtggactgtggctgccaattgccaaatatgaagagctggggggtgaactgaaatggatgggcaagcctgataagatcatctatagatcagccatggccttagttggtgtagaccctattgattctcttgcagtgggcgattctcttcatcatgacatcaagggcgcaaatgcagctgcaatccaatcagttttaaccactggtggaatccatgcaactgaacttggtagttttgccgacgtagcagatttatcttctgtgcaagctcttgcttccatatgtgatgctgacccatcatatgtgttacctgcctttacatggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HAD_2 Hydrolase_6 Hydrolase_like

Protein Analysis

187

Amino Acids

19.7

Weight (kDa)

4.41

Isoelectric Point (pI)

24.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 556
AccB1I GGYRCC 1 cut(s) 20
AccI GTMKAC 1 cut(s) 351
AcoI YGGCCR 1 cut(s) 201
AcuI CTGAAG 2 cut(s) 102, 120
AfiI CCNNNNNNNGG 1 cut(s) 558
AgsI TTSAA 1 cut(s) 68
AluBI AGCT 4 cut(s) 236, 277, 416, 506
AluI AGCT 4 cut(s) 236, 277, 416, 506
Alw21I GWGCWC 1 cut(s) 16
AoxI GGCC 4 cut(s) 37, 87, 201, 336
ApeKI GCWGC 4 cut(s) 176, 253, 413, 416
AspLEI GCGC 1 cut(s) 407
AspS9I GGNCC 2 cut(s) 37, 88
AsuHPI GGTGA 2 cut(s) 134, 296
BalI TGGCCA 1 cut(s) 203
BanI GGYRCC 1 cut(s) 20
BauI CACGAG 1 cut(s) 15
Bbv12I GWGCWC 1 cut(s) 16
BbvI GCAGC 4 cut(s) 163, 240, 403, 425
BccI CCATC 2 cut(s) 292, 541
BfaI CTAG 1 cut(s) 231
BfmI CTRYAG 1 cut(s) 322
BfuAI ACCTGC 1 cut(s) 556
BisI GCNGC 4 cut(s) 177, 254, 414, 417
BlsI GCNGC 4 cut(s) 178, 255, 415, 418
BmgT120I GGNCC 2 cut(s) 37, 88
BmiI GGNNCC 1 cut(s) 22
BmsI GCATC 3 cut(s) 61, 115, 514
BpmI CTGGAG 1 cut(s) 164
Bpu10I CCTNAGC 1 cut(s) 180
BpuEI CTTGAG 2 cut(s) 53, 173
BsaJI CCNNGG 4 cut(s) 40, 91, 105, 333
BsaXI ACNNNNNCTCC 1 cut(s) 31
Bsc4I CCNNNNNNNGG 1 cut(s) 558
Bse1I ACTGG 2 cut(s) 147, 445
BseDI CCNNGG 4 cut(s) 40, 91, 105, 333
BseGI GGATG 1 cut(s) 303
BseLI CCNNNNNNNGG 1 cut(s) 558
BseNI ACTGG 2 cut(s) 147, 445
BseXI GCAGC 4 cut(s) 163, 240, 403, 425
BseYI CCCAGC 1 cut(s) 277
BshFI GGCC 4 cut(s) 39, 89, 203, 338
BshNI GGYRCC 1 cut(s) 20
BsiHKAI GWGCWC 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 558
BsnI GGCC 4 cut(s) 39, 89, 203, 338
Bsp1286I GDGCHC 1 cut(s) 16
Bsp143I GATC 2 cut(s) 315, 326
Bsp19I CCATGG 2 cut(s) 91, 333
BspANI GGCC 4 cut(s) 39, 89, 203, 338
BspHI TCATGA 1 cut(s) 391
BspLI GGNNCC 1 cut(s) 22
BspMI ACCTGC 1 cut(s) 556
BspQI GCTCTTC 1 cut(s) 267
BspT107I GGYRCC 1 cut(s) 20
BsrI ACTGG 2 cut(s) 147, 445
BssECI CCNNGG 4 cut(s) 40, 91, 105, 333
BssMI GATC 2 cut(s) 315, 326
BssSI CACGAG 1 cut(s) 15
BssT1I CCWWGG 4 cut(s) 40, 91, 105, 333
Bst2BI CACGAG 1 cut(s) 15
Bst4CI ACNGT 2 cut(s) 223, 249
Bst6I CTCTTC 2 cut(s) 267, 390
BstC8I GCNNGC 2 cut(s) 305, 504
BstDEI CTNAG 2 cut(s) 180, 340
BstDSI CCRYGG 2 cut(s) 91, 333
BstF5I GGATG 1 cut(s) 303
BstHHI GCGC 1 cut(s) 407
BstKTI GATC 2 cut(s) 318, 329
BstMBI GATC 2 cut(s) 315, 326
BstMWI GCNNNNNNNGC 3 cut(s) 20, 413, 482
BstSFI CTRYAG 1 cut(s) 322
BstV1I GCAGC 4 cut(s) 163, 240, 403, 425
BstXI CCANNNNNNTGG 1 cut(s) 142
BsuRI GGCC 4 cut(s) 39, 89, 203, 338
BtgI CCRYGG 2 cut(s) 91, 333
BtsCI GGATG 1 cut(s) 303
BtsI GCAGTG 1 cut(s) 378
BtsIMutI CAGTG 3 cut(s) 96, 378, 438
BveI ACCTGC 1 cut(s) 556
Cac8I GCNNGC 2 cut(s) 305, 504
CciI TCATGA 1 cut(s) 391
CfoI GCGC 1 cut(s) 407
Cfr13I GGNCC 2 cut(s) 37, 88
CviAII CATG 6 cut(s) 92, 136, 334, 392, 452, 558
DdeI CTNAG 2 cut(s) 180, 340
DpnI GATC 2 cut(s) 317, 328
DpnII GATC 2 cut(s) 315, 326
EaeI YGGCCR 1 cut(s) 201
Eam1104I CTCTTC 2 cut(s) 267, 390
EarI CTCTTC 2 cut(s) 267, 390
Eco130I CCWWGG 4 cut(s) 40, 91, 105, 333
Eco57I CTGAAG 2 cut(s) 102, 120
EcoO109I RGGNCCY 1 cut(s) 37
EcoT14I CCWWGG 4 cut(s) 40, 91, 105, 333
ErhI CCWWGG 4 cut(s) 40, 91, 105, 333
FaeI CATG 6 cut(s) 95, 139, 337, 395, 455, 561
FatI CATG 6 cut(s) 91, 135, 333, 391, 451, 557
FauNDI CATATG 2 cut(s) 518, 538
FblI GTMKAC 1 cut(s) 351
Fnu4HI GCNGC 4 cut(s) 177, 254, 414, 417
FokI GGATG 1 cut(s) 310
Fsp4HI GCNGC 4 cut(s) 177, 254, 414, 417
FspBI CTAG 1 cut(s) 231
GlaI GCGC 1 cut(s) 406
GluI GCNGC 4 cut(s) 177, 254, 414, 417
GsaI CCCAGC 1 cut(s) 281
GsuI CTGGAG 1 cut(s) 164
HaeIII GGCC 4 cut(s) 39, 89, 203, 338
HhaI GCGC 1 cut(s) 407
Hin1II CATG 6 cut(s) 95, 139, 337, 395, 455, 561
Hin6I GCGC 1 cut(s) 405
HinP1I GCGC 1 cut(s) 405
HinfI GANTC 4 cut(s) 112, 362, 380, 447
HphI GGTGA 2 cut(s) 134, 296
Hpy166II GTNNAC 3 cut(s) 245, 287, 352
Hpy188III TCNNGA 4 cut(s) 32, 68, 209, 392
Hpy8I GTNNAC 3 cut(s) 245, 287, 352
Hpy99I CGWCG 1 cut(s) 482
HpyAV CCTTC 1 cut(s) 126
HpyCH4III ACNGT 2 cut(s) 223, 249
HpyCH4IV ACGT 1 cut(s) 480
HpyCH4V TGCA 6 cut(s) 128, 371, 413, 419, 455, 502
HpyF10VI GCNNNNNNNGC 3 cut(s) 20, 413, 482
HpyF3I CTNAG 2 cut(s) 180, 340
HpySE526I ACGT 1 cut(s) 480
Hsp92II CATG 6 cut(s) 95, 139, 337, 395, 455, 561
HspAI GCGC 1 cut(s) 405
Kzo9I GATC 2 cut(s) 315, 326
LguI GCTCTTC 1 cut(s) 267
LpnPI CCDG 6 cut(s) 105, 128, 222, 263, 321, 426
Lsp1109I GCAGC 4 cut(s) 163, 240, 403, 425
LweI GCATC 3 cut(s) 61, 115, 514
MaeI CTAG 1 cut(s) 231
MaeII ACGT 1 cut(s) 480
MaeIII GTNAC 2 cut(s) 217, 543
MalI GATC 2 cut(s) 317, 328
MboI GATC 2 cut(s) 315, 326
MboII GAAGA 3 cut(s) 284, 377, 486
MfeI CAATTG 1 cut(s) 258
MhlI GDGCHC 1 cut(s) 16
MlsI TGGCCA 1 cut(s) 203
MluCI AATT 2 cut(s) 129, 258
MluNI TGGCCA 1 cut(s) 203
MnlI CCTC 3 cut(s) 28, 139, 220
Mox20I TGGCCA 1 cut(s) 203
MscI TGGCCA 1 cut(s) 203
MseI TTAA 1 cut(s) 434
MslI CAYNNNNRTG 1 cut(s) 191
Msp20I TGGCCA 1 cut(s) 203
MspA1I CMGCKG 1 cut(s) 416
MunI CAATTG 1 cut(s) 258
MwoI GCNNNNNNNGC 3 cut(s) 20, 413, 482
NcoI CCATGG 2 cut(s) 91, 333
NdeI CATATG 2 cut(s) 518, 538
NdeII GATC 2 cut(s) 315, 326
NlaIII CATG 6 cut(s) 95, 139, 337, 395, 455, 561
NlaIV GGNNCC 1 cut(s) 22
NmuCI GTSAC 1 cut(s) 217
PagI TCATGA 1 cut(s) 391
PciSI GCTCTTC 1 cut(s) 267
PfeI GAWTC 4 cut(s) 112, 362, 380, 447
PkrI GCNGC 4 cut(s) 178, 255, 415, 418
PspFI CCCAGC 1 cut(s) 277
PspN4I GGNNCC 1 cut(s) 22
PspPI GGNCC 2 cut(s) 37, 88
PvuII CAGCTG 1 cut(s) 416
RseI CAYNNNNRTG 1 cut(s) 191
SapI GCTCTTC 1 cut(s) 267
SaqAI TTAA 1 cut(s) 434
SatI GCNGC 4 cut(s) 177, 254, 414, 417
Sau3AI GATC 2 cut(s) 315, 326
Sau96I GGNCC 2 cut(s) 37, 88
SduI GDGCHC 1 cut(s) 16
SetI ASST 7 cut(s) 124, 238, 279, 418, 483, 508, 550
SfaNI GCATC 3 cut(s) 61, 115, 514
SfcI CTRYAG 1 cut(s) 322
SmiMI CAYNNNNRTG 1 cut(s) 191
SmlI CTYRAG 2 cut(s) 32, 152
SmoI CTYRAG 2 cut(s) 32, 152
Sse9I AATT 2 cut(s) 129, 258
SspMI CTAG 1 cut(s) 231
StyI CCWWGG 4 cut(s) 40, 91, 105, 333
TaaI ACNGT 2 cut(s) 223, 249
TaiI ACGT 1 cut(s) 483
TasI AATT 2 cut(s) 129, 258
TfiI GAWTC 4 cut(s) 112, 362, 380, 447
Tru1I TTAA 1 cut(s) 434
Tru9I TTAA 1 cut(s) 434
TscAI CASTG 3 cut(s) 103, 378, 445
TseFI GTSAC 1 cut(s) 217
TseI GCWGC 4 cut(s) 176, 253, 413, 416
Tsp45I GTSAC 1 cut(s) 217
TspDTI ATGAA 3 cut(s) 152, 285, 377
TspRI CASTG 3 cut(s) 103, 378, 445
XmiI GTMKAC 1 cut(s) 351
XspI CTAG 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.