Rmu_sc0009466.1_g000003

Dynein light chain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009466.1
Physical Location & Seq
Forward (+)
7615 .. 9545
1931 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009466.1_g000003.1.cds

Sequence Viewer

Length: 477 bp
atgggtaggccgcctggtagcaggaataagagccaacactctgggaagaaggtgggaacggcccctctgagactcacctaccctgcagtcggtgcttcagcagcaagcgattcccagtcccggcaggtttcctcttcagctatgttagaaggcaaagcggtagttaacgagactgatatgcttgaaacaatgcagcaagaagcactccaattagccgccaaggctctcgatatgtttgatgtcactcaacctactgaaatagctcaattcataaagaaggaattcgatgaatcgtatggagctgggtggcaatgcatagtgggaacagattttggttcgtttgtgacccacagccaggggtgttttatccatttctgcataggtagccttgcattcttgctctttaggggtgcagctaatctagccacctcggcggagctaaataggattccgacattggaggcctcaaatgcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

158

Amino Acids

16.86

Weight (kDa)

5.88

Isoelectric Point (pI)

32.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 115
AciI CCGC 4 cut(s) 11, 158, 216, 434
AcsI RAATTY 1 cut(s) 281
AcuI CTGAAG 2 cut(s) 81, 120
AfiI CCNNNNNNNGG 3 cut(s) 89, 120, 355
AgsI TTSAA 1 cut(s) 185
AjnI CCWGG 2 cut(s) 13, 354
AluBI AGCT 5 cut(s) 140, 263, 302, 416, 439
AluI AGCT 5 cut(s) 140, 263, 302, 416, 439
Alw26I GTCTC 2 cut(s) 64, 164
AoxI GGCC 3 cut(s) 8, 60, 462
ApeKI GCWGC 3 cut(s) 101, 193, 413
ApoI RAATTY 1 cut(s) 281
Asp700I GAANNNNTTC 1 cut(s) 281
AspS9I GGNCC 1 cut(s) 61
AsuC2I CCSGG 1 cut(s) 121
AsuHPI GGTGA 1 cut(s) 67
BbvI GCAGC 3 cut(s) 113, 205, 425
BceAI ACGGC 1 cut(s) 75
BciT130I CCWGG 2 cut(s) 15, 356
BcnI CCSGG 1 cut(s) 121
BcoDI GTCTC 2 cut(s) 64, 164
BfaI CTAG 1 cut(s) 422
BfmI CTRYAG 1 cut(s) 84
BfuAI ACCTGC 1 cut(s) 115
BglI GCCNNNNNGGC 2 cut(s) 221, 431
BisI GCNGC 5 cut(s) 11, 102, 194, 216, 414
BlsI GCNGC 5 cut(s) 12, 103, 195, 217, 415
Bme1390I CCNGG 3 cut(s) 15, 121, 356
BmgT120I GGNCC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 63
BmrFI CCNGG 3 cut(s) 15, 121, 356
BmrI ACTGGG 1 cut(s) 109
BmuI ACTGGG 1 cut(s) 109
BpuMI CCSGG 1 cut(s) 121
BsaJI CCNNGG 3 cut(s) 219, 355, 429
Bsc4I CCNNNNNNNGG 3 cut(s) 89, 120, 355
Bse1I ACTGG 1 cut(s) 115
Bse3DI GCAATG 1 cut(s) 317
BseBI CCWGG 2 cut(s) 15, 356
BseDI CCNNGG 3 cut(s) 219, 355, 429
BseLI CCNNNNNNNGG 3 cut(s) 89, 120, 355
BseMI GCAATG 1 cut(s) 317
BseMII CTCAG 1 cut(s) 59
BseNI ACTGG 1 cut(s) 115
BseXI GCAGC 3 cut(s) 113, 205, 425
BseYI CCCAGC 1 cut(s) 302
BsgI GTGCAG 1 cut(s) 432
BshFI GGCC 3 cut(s) 10, 62, 464
BsiSI CCGG 1 cut(s) 121
BslFI GGGAC 1 cut(s) 103
BslI CCNNNNNNNGG 3 cut(s) 89, 120, 355
BsmAI GTCTC 2 cut(s) 64, 164
BsmFI GGGAC 1 cut(s) 103
BsmI GAATGC 1 cut(s) 392
BsnI GGCC 3 cut(s) 10, 62, 464
BspACI CCGC 4 cut(s) 11, 158, 216, 434
BspANI GGCC 3 cut(s) 10, 62, 464
BspCNI CTCAG 1 cut(s) 60
BspLI GGNNCC 1 cut(s) 63
BspMAI CTGCAG 1 cut(s) 88
BspMI ACCTGC 1 cut(s) 115
BsrDI GCAATG 1 cut(s) 317
BsrI ACTGG 1 cut(s) 115
BssECI CCNNGG 3 cut(s) 219, 355, 429
BssT1I CCWWGG 1 cut(s) 219
Bst2UI CCWGG 2 cut(s) 15, 356
Bst6I CTCTTC 1 cut(s) 139
BstAPI GCANNNNNTGC 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 106
BstDEI CTNAG 1 cut(s) 68
BstMAI GTCTC 2 cut(s) 64, 164
BstMWI GCNNNNNNNGC 7 cut(s) 92, 101, 221, 384, 422, 431, 470
BstNI CCWGG 2 cut(s) 15, 356
BstSCI CCNGG 3 cut(s) 13, 119, 354
BstSFI CTRYAG 1 cut(s) 84
BstV1I GCAGC 3 cut(s) 113, 205, 425
BstXI CCANNNNNNTGG 1 cut(s) 41
BsuRI GGCC 3 cut(s) 10, 62, 464
BveI ACCTGC 1 cut(s) 115
Cac8I GCNNGC 1 cut(s) 106
Cfr13I GGNCC 1 cut(s) 61
DdeI CTNAG 1 cut(s) 68
Eam1104I CTCTTC 1 cut(s) 139
EarI CTCTTC 1 cut(s) 139
EciI GGCGGA 1 cut(s) 449
Eco130I CCWWGG 1 cut(s) 219
Eco147I AGGCCT 1 cut(s) 464
Eco57I CTGAAG 2 cut(s) 81, 120
EcoRI GAATTC 1 cut(s) 281
EcoRII CCWGG 2 cut(s) 13, 354
EcoT14I CCWWGG 1 cut(s) 219
EcoT22I ATGCAT 2 cut(s) 317, 475
ErhI CCWWGG 1 cut(s) 219
FaiI YATR 8 cut(s) 143, 179, 233, 272, 297, 317, 380, 475
FaqI GGGAC 1 cut(s) 103
Fnu4HI GCNGC 5 cut(s) 11, 102, 194, 216, 414
Fsp4HI GCNGC 5 cut(s) 11, 102, 194, 216, 414
FspBI CTAG 1 cut(s) 422
GluI GCNGC 5 cut(s) 11, 102, 194, 216, 414
GsaI CCCAGC 1 cut(s) 306
HaeIII GGCC 3 cut(s) 10, 62, 464
HapII CCGG 1 cut(s) 121
HincII GTYRAC 1 cut(s) 166
HindII GTYRAC 1 cut(s) 166
HinfI GANTC 4 cut(s) 72, 110, 290, 448
HpaI GTTAAC 1 cut(s) 166
HpaII CCGG 1 cut(s) 121
HphI GGTGA 1 cut(s) 67
Hpy166II GTNNAC 1 cut(s) 166
Hpy188I TCNGA 2 cut(s) 69, 453
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 1 cut(s) 166
HpyAV CCTTC 3 cut(s) 43, 143, 271
HpyCH4V TGCA 7 cut(s) 86, 193, 315, 378, 392, 413, 473
HpyF10VI GCNNNNNNNGC 7 cut(s) 92, 101, 221, 384, 422, 431, 470
HpyF3I CTNAG 1 cut(s) 68
KspAI GTTAAC 1 cut(s) 166
LmnI GCTCC 2 cut(s) 299, 436
Lsp1109I GCAGC 3 cut(s) 113, 205, 425
MaeI CTAG 1 cut(s) 422
MaeIII GTNAC 2 cut(s) 241, 343
MboII GAAGA 2 cut(s) 58, 126
MluCI AATT 3 cut(s) 209, 266, 281
MlyI GAGTC 1 cut(s) 66
MmeI TCCRAC 1 cut(s) 476
MnlI CCTC 5 cut(s) 75, 142, 439, 454, 475
Mph1103I ATGCAT 2 cut(s) 317, 475
MroXI GAANNNNTTC 1 cut(s) 281
MseI TTAA 1 cut(s) 165
MspI CCGG 1 cut(s) 121
MspR9I CCNGG 3 cut(s) 15, 121, 356
Mva1269I GAATGC 1 cut(s) 392
MvaI CCWGG 2 cut(s) 15, 356
MwoI GCNNNNNNNGC 7 cut(s) 92, 101, 221, 384, 422, 431, 470
NciI CCSGG 1 cut(s) 121
NlaIV GGNNCC 1 cut(s) 63
NmeAIII GCCGAG 1 cut(s) 410
NmuCI GTSAC 2 cut(s) 241, 343
NsiI ATGCAT 2 cut(s) 317, 475
PceI AGGCCT 1 cut(s) 464
PctI GAATGC 1 cut(s) 392
PdmI GAANNNNTTC 1 cut(s) 281
PfeI GAWTC 3 cut(s) 110, 290, 448
PkrI GCNGC 5 cut(s) 12, 103, 195, 217, 415
PleI GAGTC 1 cut(s) 66
PpsI GAGTC 1 cut(s) 66
Psp6I CCWGG 2 cut(s) 13, 354
PspFI CCCAGC 1 cut(s) 302
PspGI CCWGG 2 cut(s) 13, 354
PspN4I GGNNCC 1 cut(s) 63
PspPI GGNCC 1 cut(s) 61
PstI CTGCAG 1 cut(s) 88
SaqAI TTAA 1 cut(s) 165
SatI GCNGC 5 cut(s) 11, 102, 194, 216, 414
Sau96I GGNCC 1 cut(s) 61
SchI GAGTC 1 cut(s) 66
ScrFI CCNGG 3 cut(s) 15, 121, 356
SfcI CTRYAG 1 cut(s) 84
Sse9I AATT 3 cut(s) 209, 266, 281
SseBI AGGCCT 1 cut(s) 464
SsiI CCGC 4 cut(s) 11, 158, 216, 434
SspMI CTAG 1 cut(s) 422
StuI AGGCCT 1 cut(s) 464
StyD4I CCNGG 3 cut(s) 13, 119, 354
StyI CCWWGG 1 cut(s) 219
TaqI TCGA 2 cut(s) 228, 285
TasI AATT 3 cut(s) 209, 266, 281
TauI GCSGC 2 cut(s) 13, 218
TfiI GAWTC 3 cut(s) 110, 290, 448
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TseFI GTSAC 2 cut(s) 241, 343
TseI GCWGC 3 cut(s) 101, 193, 413
Tsp45I GTSAC 2 cut(s) 241, 343
TspDTI ATGAA 2 cut(s) 259, 303
XapI RAATTY 1 cut(s) 281
XmnI GAANNNNTTC 1 cut(s) 281
XspI CTAG 1 cut(s) 422
Zsp2I ATGCAT 2 cut(s) 317, 475
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.