Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009684.1

Orthogroup ID

OG0008339

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1762

Gene Structure 1762 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009684.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 762 bp

tatgtgctgaaaccggctctaggggtgttaattgcaatggcatttggcgtgcctagaatattctacgctgggtttgtcctcaccacttgtgttgcaggggcacagctatctagttatgctagtttcttgagcaaaggagatgtggccttgagtatcctcctcactagctccaccacaattacctcggtgatcgttacccctctactgacaggccttttaattggttctgtagttccggtcgatgctgttgccatggcaaagtcaatattgcaggttgttcttgttccggtcactattggccttgctctgaatacttatgccaaaccagttgtcaccatccttcaaccagtgatgccatttgttgctatgatctgtacttcattgtgcattggcagtcctcttgcaattaatcaaagacaaattctgtctatggatggtctccgattgatatttcctgttttagcatttcatgcagtggcctttactgttggatactgggtatccaaaattccaagtgtaaggcaagaagaagaagttagcagaacactttcattatgcacaggaatgcaaagctccaccctggcaggtctccttgcaagccagttccttgggagcagtcaagccgttcctccagcatgttcggttgttgccatggccatcatgggcctttttcttgcctctttctggggcacgggtgctcgaattcgagacctttctaccctactaatgcctcaaaccagttctaccatgaacgcttcatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009526 GO:0009536 GO:0009941 GO:0031967 GO:0031975 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SBF

Protein Analysis

253

Amino Acids

26.46

Weight (kDa)

9.12

Isoelectric Point (pI)

47.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008339)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G25410
fragaria_vesca	FvH4_2g17730 FvH4_2g17730 FvH4_2g17730 FvH4_2g17730
malus_domestica	MD05G1158500.v1.1 MD10G1151500.v1.1
prunus_persica	Prupe.8G189900_v2.0.a1
pyrus_communis	pycom05g15050 pycom10g13060
rosa_chinensis	RchiOBHm_Chr1g0359741 RchiOBHm_Chr6g0282771
rosa_laevigata	RLG00000012871
rosa_multiflora	Rmu_sc0009684.1_g000001
rosa_roxburghii	Rroxscaffold_7G00186080
rosa_rugosa	Rorug06G0149100
rosa_samantha	Rh1AG286400 Rh1BG252400 Rh6AG262400 Rh6BG265400 Rh6CG264700 Rh6DG257200
rosa_wichuraiana	Rw6G022670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	262, 575
AcoI	YGGCCR	1 cut(s)	654
AcsI	RAATTY	3 cut(s)	420, 507, 702
AfaI	GTAC	1 cut(s)	376
AfiI	CCNNNNNNNGG	2 cut(s)	20, 684
AgsI	TTSAA	1 cut(s)	344
AjnI	CCWGG	1 cut(s)	579
AluBI	AGCT	3 cut(s)	106, 168, 573
AluI	AGCT	3 cut(s)	106, 168, 573
Alw21I	GWGCWC	1 cut(s)	700
Alw26I	GTCTC	3 cut(s)	443, 593, 702
AoxI	GGCC	6 cut(s)	144, 211, 298, 477, 654, 664
ApoI	RAATTY	3 cut(s)	420, 507, 702
ArsI	GACNNNNNNTTYG	2 cut(s)	315, 347
AseI	ATTAAT	1 cut(s)	408
Asp700I	GAANNNNTTC	1 cut(s)	547
AspS9I	GGNCC	1 cut(s)	664
AsuHPI	GGTGA	3 cut(s)	73, 199, 325
BaeGI	GKGCMC	2 cut(s)	103, 692
BalI	TGGCCA	1 cut(s)	656
Bbv12I	GWGCWC	1 cut(s)	700
BccI	CCATC	3 cut(s)	344, 428, 665
BceAI	ACGGC	1 cut(s)	608
BcgI	CGANNNNNNTGC	2 cut(s)	230, 264
BciT130I	CCWGG	1 cut(s)	581
BciVI	GTATCC	3 cut(s)	164, 485, 511
BcoDI	GTCTC	3 cut(s)	443, 593, 702
BfaI	CTAG	5 cut(s)	20, 54, 111, 120, 165
BfmI	CTRYAG	1 cut(s)	228
BfuAI	ACCTGC	2 cut(s)	262, 575
BfuI	GTATCC	3 cut(s)	164, 485, 511
Bme1390I	CCNGG	1 cut(s)	581
BmgT120I	GGNCC	1 cut(s)	664
BmrFI	CCNGG	1 cut(s)	581
BmrI	ACTGGG	1 cut(s)	505
BmsI	GCATC	2 cut(s)	232, 342
BmuI	ACTGGG	1 cut(s)	505
BpmI	CTGGAG	1 cut(s)	615
BpuEI	CTTGAG	2 cut(s)	148, 169
BsaI	GGTCTC	3 cut(s)	443, 593, 702
BsaJI	CCNNGG	5 cut(s)	183, 252, 579, 607, 651
BsaWI	WCCGGW	2 cut(s)	235, 286
Bsc4I	CCNNNNNNNGG	2 cut(s)	20, 684
Bse118I	RCCGGY	1 cut(s)	13
Bse1I	ACTGG	5 cut(s)	326, 347, 500, 601, 738
Bse3DI	GCAATG	1 cut(s)	42
BseBI	CCWGG	1 cut(s)	581
BseDI	CCNNGG	5 cut(s)	183, 252, 579, 607, 651
BseGI	GGATG	2 cut(s)	336, 439
BseLI	CCNNNNNNNGG	2 cut(s)	20, 684
BseMI	GCAATG	1 cut(s)	42
BseNI	ACTGG	5 cut(s)	326, 347, 500, 601, 738
BseRI	GAGGAG	1 cut(s)	149
BseSI	GKGCMC	2 cut(s)	103, 692
BseYI	CCCAGC	1 cut(s)	68
Bsh1285I	CGRYCG	1 cut(s)	240
BshFI	GGCC	6 cut(s)	146, 213, 300, 479, 656, 666
BsiEI	CGRYCG	1 cut(s)	240
BsiHKAI	GWGCWC	1 cut(s)	700
BsiSI	CCGG	3 cut(s)	14, 236, 287
BslI	CCNNNNNNNGG	2 cut(s)	20, 684
BsmAI	GTCTC	3 cut(s)	443, 593, 702
BsmI	GAATGC	1 cut(s)	570
BsnI	GGCC	6 cut(s)	146, 213, 300, 479, 656, 666
Bso31I	GGTCTC	3 cut(s)	443, 593, 702
Bsp1286I	GDGCHC	3 cut(s)	103, 692, 700
Bsp143I	GATC	2 cut(s)	189, 369
Bsp19I	CCATGG	2 cut(s)	252, 651
BspANI	GGCC	6 cut(s)	146, 213, 300, 479, 656, 666
BspMI	ACCTGC	2 cut(s)	262, 575
BspTNI	GGTCTC	3 cut(s)	443, 593, 702
BsrDI	GCAATG	1 cut(s)	42
BsrFI	RCCGGY	1 cut(s)	13
BsrI	ACTGG	5 cut(s)	326, 347, 500, 601, 738
BssAI	RCCGGY	1 cut(s)	13
BssECI	CCNNGG	5 cut(s)	183, 252, 579, 607, 651
BssMI	GATC	2 cut(s)	189, 369
BssT1I	CCWWGG	3 cut(s)	252, 607, 651
Bst2UI	CCWGG	1 cut(s)	581
Bst4CI	ACNGT	1 cut(s)	487
BstAPI	GCANNNNNTGC	1 cut(s)	470
BstC8I	GCNNGC	2 cut(s)	50, 598
BstDSI	CCRYGG	2 cut(s)	252, 651
BstF5I	GGATG	2 cut(s)	336, 439
BstKTI	GATC	2 cut(s)	192, 372
BstMAI	GTCTC	3 cut(s)	443, 593, 702
BstMBI	GATC	2 cut(s)	189, 369
BstMCI	CGRYCG	1 cut(s)	240
BstMWI	GCNNNNNNNGC	1 cut(s)	470
BstNI	CCWGG	1 cut(s)	581
BstNSI	RCATGY	1 cut(s)	639
BstSCI	CCNGG	1 cut(s)	579
BstSFI	CTRYAG	1 cut(s)	228
BstSLI	GKGCMC	2 cut(s)	103, 692
BstXI	CCANNNNNNTGG	1 cut(s)	608
BsuI	GTATCC	3 cut(s)	164, 485, 511
BsuRI	GGCC	6 cut(s)	146, 213, 300, 479, 656, 666
BtgI	CCRYGG	2 cut(s)	252, 651
BtsCI	GGATG	2 cut(s)	336, 439
BtsI	GCAGTG	1 cut(s)	480
BtsIMutI	CAGTG	2 cut(s)	354, 480
BveI	ACCTGC	2 cut(s)	262, 575
Cac8I	GCNNGC	2 cut(s)	50, 598
Cfr10I	RCCGGY	1 cut(s)	13
Cfr13I	GGNCC	1 cut(s)	664
Csp6I	GTAC	1 cut(s)	375
CspCI	CAANNNNNGTGG	2 cut(s)	73, 108
CviAII	CATG	6 cut(s)	253, 470, 636, 652, 661, 748
CviQI	GTAC	1 cut(s)	375
DpnI	GATC	2 cut(s)	191, 371
DpnII	GATC	2 cut(s)	189, 369
EaeI	YGGCCR	1 cut(s)	654
Eco130I	CCWWGG	3 cut(s)	252, 607, 651
Eco147I	AGGCCT	1 cut(s)	213
Eco31I	GGTCTC	3 cut(s)	443, 593, 702
EcoRI	GAATTC	1 cut(s)	702
EcoRII	CCWGG	1 cut(s)	579
EcoT14I	CCWWGG	3 cut(s)	252, 607, 651
ErhI	CCWWGG	3 cut(s)	252, 607, 651
FaeI	CATG	6 cut(s)	256, 473, 639, 655, 664, 751
FatI	CATG	6 cut(s)	252, 469, 635, 651, 660, 747
FokI	GGATG	2 cut(s)	323, 446
FspBI	CTAG	5 cut(s)	20, 54, 111, 120, 165
GsaI	CCCAGC	1 cut(s)	72
GsuI	CTGGAG	1 cut(s)	615
HaeIII	GGCC	6 cut(s)	146, 213, 300, 479, 656, 666
HapII	CCGG	3 cut(s)	14, 236, 287
Hin1II	CATG	6 cut(s)	256, 473, 639, 655, 664, 751
HpaII	CCGG	3 cut(s)	14, 236, 287
HphI	GGTGA	3 cut(s)	73, 199, 325
Hpy188I	TCNGA	2 cut(s)	309, 443
Hpy188III	TCNNGA	2 cut(s)	127, 707
HpyAV	CCTTC	1 cut(s)	350
HpyCH4III	ACNGT	1 cut(s)	487
HpyCH4V	TGCA	9 cut(s)	35, 95, 271, 387, 404, 473, 558, 568, 596
HpyF10VI	GCNNNNNNNGC	1 cut(s)	470
Hsp92II	CATG	6 cut(s)	256, 473, 639, 655, 664, 751
Kzo9I	GATC	2 cut(s)	189, 369
LmnI	GCTCC	3 cut(s)	173, 578, 612
LweI	GCATC	2 cut(s)	232, 342
MaeI	CTAG	5 cut(s)	20, 54, 111, 120, 165
MaeIII	GTNAC	3 cut(s)	193, 289, 331
MalI	GATC	2 cut(s)	191, 371
MboI	GATC	2 cut(s)	189, 369
MboII	GAAGA	2 cut(s)	539, 542
MhlI	GDGCHC	3 cut(s)	103, 692, 700
MlsI	TGGCCA	1 cut(s)	656
MluCI	AATT	7 cut(s)	30, 177, 219, 405, 420, 507, 702
MluNI	TGGCCA	1 cut(s)	656
MmeI	TCCRAC	1 cut(s)	469
MnlI	CCTC	9 cut(s)	89, 167, 170, 193, 210, 408, 639, 688, 741
Mox20I	TGGCCA	1 cut(s)	656
MroXI	GAANNNNTTC	1 cut(s)	547
MscI	TGGCCA	1 cut(s)	656
MseI	TTAA	3 cut(s)	29, 218, 408
MslI	CAYNNNNRTG	1 cut(s)	563
Msp20I	TGGCCA	1 cut(s)	656
MspI	CCGG	3 cut(s)	14, 236, 287
MspR9I	CCNGG	1 cut(s)	581
Mva1269I	GAATGC	1 cut(s)	570
MvaI	CCWGG	1 cut(s)	581
MwoI	GCNNNNNNNGC	1 cut(s)	470
NcoI	CCATGG	2 cut(s)	252, 651
NdeII	GATC	2 cut(s)	189, 369
NlaIII	CATG	6 cut(s)	256, 473, 639, 655, 664, 751
NmuCI	GTSAC	2 cut(s)	289, 331
NspI	RCATGY	1 cut(s)	639
PceI	AGGCCT	1 cut(s)	213
PctI	GAATGC	1 cut(s)	570
PdmI	GAANNNNTTC	1 cut(s)	547
PshBI	ATTAAT	1 cut(s)	408
Psp6I	CCWGG	1 cut(s)	579
PspFI	CCCAGC	1 cut(s)	68
PspGI	CCWGG	1 cut(s)	579
PspPI	GGNCC	1 cut(s)	664
RsaI	GTAC	1 cut(s)	376
RsaNI	GTAC	1 cut(s)	375
RseI	CAYNNNNRTG	1 cut(s)	563
SaqAI	TTAA	3 cut(s)	29, 218, 408
Sau3AI	GATC	2 cut(s)	189, 369
Sau96I	GGNCC	1 cut(s)	664
ScrFI	CCNGG	1 cut(s)	581
SduI	GDGCHC	3 cut(s)	103, 692, 700
SetI	ASST	7 cut(s)	108, 170, 185, 276, 575, 589, 714
SfaNI	GCATC	2 cut(s)	232, 342
SfcI	CTRYAG	1 cut(s)	228
SmiMI	CAYNNNNRTG	1 cut(s)	563
SmlI	CTYRAG	2 cut(s)	127, 148
SmoI	CTYRAG	2 cut(s)	127, 148
Sse9I	AATT	7 cut(s)	30, 177, 219, 405, 420, 507, 702
SseBI	AGGCCT	1 cut(s)	213
SspI	AATATT	2 cut(s)	60, 267
SspMI	CTAG	5 cut(s)	20, 54, 111, 120, 165
StuI	AGGCCT	1 cut(s)	213
StyD4I	CCNGG	1 cut(s)	579
StyI	CCWWGG	3 cut(s)	252, 607, 651
TaaI	ACNGT	1 cut(s)	487
TaqI	TCGA	3 cut(s)	240, 700, 706
TasI	AATT	7 cut(s)	30, 177, 219, 405, 420, 507, 702
TatI	WGTACW	1 cut(s)	374
Tru1I	TTAA	3 cut(s)	29, 218, 408
Tru9I	TTAA	3 cut(s)	29, 218, 408
TscAI	CASTG	2 cut(s)	354, 480
TseFI	GTSAC	2 cut(s)	289, 331
Tsp45I	GTSAC	2 cut(s)	289, 331
TspDTI	ATGAA	4 cut(s)	369, 458, 540, 747
TspRI	CASTG	2 cut(s)	354, 480
VspI	ATTAAT	1 cut(s)	408
XapI	RAATTY	3 cut(s)	420, 507, 702
XceI	RCATGY	1 cut(s)	639
XcmI	CCANNNNNNNNNTGG	1 cut(s)	658
XmnI	GAANNNNTTC	1 cut(s)	547
XspI	CTAG	5 cut(s)	20, 54, 111, 120, 165

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.