Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010153.1

Orthogroup ID

OG0004944

Physical Location & Seq

Genomic Coordinates Forward (+)

4437 .. 14067

Gene Structure 9631 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010153.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 972 bp

atggaaagagaaggagaagacgacgacgacatggtttgcttagacgaatcgtttttcatcgatgacaattaccagctgaccactttcacatttgggtctcaagttgttcaactcctttgcctccaatctgcttccactgattttgatcttacaggacaattggtgtggccaggggcaatgctgttgaatgattacctttctaagaatgcagagatcctgcaaggatgcactgttattgagttagggtctggggttggtattactggaatactatgcagcagattttgcagtcaagttgttttaacagaccacaatgaagaagtgctcaagatcttgaataaaaatatagagctacacgcatcttctgataatcctgaatactgtgctggattagcagcggagaaactagaatggggaaattctgagcagatctcccagattttacaaaagtattcaagaggaaaagaaggaaagtgcaaattcatactagcctatgtgtcccgtgctaagaccatggattcattggtcattagtgaagcggcccgacgtaagatgcagataaatgaattagttgggactcgatccttcgttggcaatctcgaaggacttatctatgaggaaaagatgaaaaacctgaacaagctggatttcacaccactagatacaacgggcatagaataccacaagtgggtttgtgacgttcgcaaccacctgaaggcccaagggatcttatctgcgatccgagagcaacctactgctgctgtggaacttgatcaagcagccactgatgccttagaggccaagaatgccaaggcaatcattatcatgattcattatatggacgagtctcttcaatccaagtacctcaatgaggcggaccttaaaaggctatggatagcacttgaagaacggcttggcaatgtcagtgagtcattgcttcctgacctagagatgaagtggcaaaatccttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Methyltransf_16

Protein Analysis

323

Amino Acids

36.3

Weight (kDa)

4.7

Isoelectric Point (pI)

48.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004944)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G26810 AT2G26810 AT2G26810 AT2G26810 AT2G26810 AT2G26810 AT2G26810
fragaria_vesca	FvH4_3g28160 FvH4_3g28160 FvH4_3g28160 FvH4_3g28160 FvH4_3g28160 FvH4_3g28160
malus_domestica	MD00G1134600.v1.1
prunus_persica	Prupe.4G260400_v2.0.a1 Prupe.4G260400_v2.0.a1
pyrus_communis	pycom12561g00240
rosa_chinensis	RchiOBHm_Chr5g0050231 RchiOBHm_Chr5g0050251
rosa_laevigata	RLG00000034691
rosa_multiflora	Rmu_sc0010153.1_g000001
rosa_roxburghii	Rroxscaffold_1G00030770
rosa_rugosa	Rorug05G0240400.1 Rorug05G0259700 Rorug05G0259700
rosa_samantha	Rh5AG331200 Rh5BG341800 Rh5CG368700 Rh5DG354600
rosa_wichuraiana	Rw5G031300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	398, 539, 875
AclWI	GGATC	4 cut(s)	208, 576, 733, 734
AcoI	YGGCCR	1 cut(s)	167
AcsI	RAATTY	2 cut(s)	418, 479
AcuI	CTGAAG	1 cut(s)	734
AfaI	GTAC	1 cut(s)	863
AfiI	CCNNNNNNNGG	3 cut(s)	688, 715, 871
AgsI	TTSAA	6 cut(s)	110, 187, 337, 456, 854, 905
AjnI	CCWGG	1 cut(s)	169
AjuI	GAANNNNNNNTTGG	2 cut(s)	897, 929
AluBI	AGCT	3 cut(s)	76, 352, 643
AluI	AGCT	3 cut(s)	76, 352, 643
Alw21I	GWGCWC	1 cut(s)	327
Alw26I	GTCTC	2 cut(s)	102, 852
AlwI	GGATC	4 cut(s)	208, 576, 733, 734
AlwNI	CAGNNNCTG	1 cut(s)	785
AoxI	GGCC	4 cut(s)	167, 540, 717, 798
ApeKI	GCWGC	4 cut(s)	276, 395, 758, 779
ApoI	RAATTY	2 cut(s)	418, 479
AspS9I	GGNCC	3 cut(s)	541, 718, 877
AvaII	GGWCC	1 cut(s)	877
BalI	TGGCCA	1 cut(s)	169
BbsI	GAAGAC	1 cut(s)	24
Bbv12I	GWGCWC	1 cut(s)	327
BbvI	GCAGC	4 cut(s)	288, 407, 745, 791
BceAI	ACGGC	1 cut(s)	926
BciT130I	CCWGG	1 cut(s)	171
BclI	TGATCA	1 cut(s)	772
BcoDI	GTCTC	2 cut(s)	102, 852
BfaI	CTAG	4 cut(s)	407, 488, 659, 947
BglI	GCCNNNNNGGC	1 cut(s)	797
BglII	AGATCT	2 cut(s)	330, 429
BisI	GCNGC	5 cut(s)	277, 396, 540, 759, 780
BlsI	GCNGC	5 cut(s)	278, 397, 541, 760, 781
Bme1390I	CCNGG	1 cut(s)	171
Bme18I	GGWCC	1 cut(s)	877
BmgT120I	GGNCC	3 cut(s)	541, 718, 877
BmrFI	CCNGG	1 cut(s)	171
BmsI	GCATC	4 cut(s)	215, 368, 543, 778
BpiI	GAAGAC	1 cut(s)	24
BplI	GAGNNNNNCTC	2 cut(s)	416, 448
BpuEI	CTTGAG	2 cut(s)	84, 311
Bsa29I	ATCGAT	1 cut(s)	60
BsaBI	GATNNNNATC	1 cut(s)	144
BsaI	GGTCTC	1 cut(s)	102
BsaJI	CCNNGG	4 cut(s)	170, 513, 721, 810
Bsc4I	CCNNNNNNNGG	3 cut(s)	688, 715, 871
Bse1I	ACTGG	1 cut(s)	268
Bse3DI	GCAATG	3 cut(s)	183, 925, 932
Bse8I	GATNNNNATC	1 cut(s)	144
BseBI	CCWGG	1 cut(s)	171
BseCI	ATCGAT	1 cut(s)	60
BseDI	CCNNGG	4 cut(s)	170, 513, 721, 810
BseGI	GGATG	1 cut(s)	230
BseJI	GATNNNNATC	1 cut(s)	144
BseLI	CCNNNNNNNGG	3 cut(s)	688, 715, 871
BseMI	GCAATG	3 cut(s)	183, 925, 932
BseMII	CTCAG	1 cut(s)	414
BseNI	ACTGG	1 cut(s)	268
BseXI	GCAGC	4 cut(s)	288, 407, 745, 791
BshFI	GGCC	4 cut(s)	169, 542, 719, 800
BshVI	ATCGAT	1 cut(s)	60
BsiHKAI	GWGCWC	1 cut(s)	327
BslFI	GGGAC	2 cut(s)	484, 589
BslI	CCNNNNNNNGG	3 cut(s)	688, 715, 871
BsmAI	GTCTC	2 cut(s)	102, 852
BsmFI	GGGAC	2 cut(s)	484, 589
BsmI	GAATGC	2 cut(s)	211, 811
BsnI	GGCC	4 cut(s)	169, 542, 719, 800
Bso31I	GGTCTC	1 cut(s)	102
Bsp1286I	GDGCHC	1 cut(s)	327
Bsp143I	GATC	8 cut(s)	145, 213, 330, 429, 581, 726, 738, 772
Bsp19I	CCATGG	1 cut(s)	513
BspACI	CCGC	3 cut(s)	398, 539, 875
BspANI	GGCC	4 cut(s)	169, 542, 719, 800
BspCNI	CTCAG	1 cut(s)	415
BspDI	ATCGAT	1 cut(s)	60
BspHI	TCATGA	1 cut(s)	825
BspPI	GGATC	4 cut(s)	208, 576, 733, 734
BspTNI	GGTCTC	1 cut(s)	102
BsrDI	GCAATG	3 cut(s)	183, 925, 932
BsrI	ACTGG	1 cut(s)	268
BssECI	CCNNGG	4 cut(s)	170, 513, 721, 810
BssMI	GATC	8 cut(s)	145, 213, 330, 429, 581, 726, 738, 772
BssT1I	CCWWGG	3 cut(s)	513, 721, 810
Bst2UI	CCWGG	1 cut(s)	171
Bst4CI	ACNGT	2 cut(s)	232, 383
Bst6I	CTCTTC	1 cut(s)	855
BstAPI	GCANNNNNTGC	1 cut(s)	285
BstDEI	CTNAG	5 cut(s)	40, 201, 423, 507, 793
BstDSI	CCRYGG	1 cut(s)	513
BstENI	CCTNNNNNAGG	1 cut(s)	869
BstF5I	GGATG	1 cut(s)	230
BstKTI	GATC	8 cut(s)	148, 216, 333, 432, 584, 729, 741, 775
BstMAI	GTCTC	2 cut(s)	102, 852
BstMBI	GATC	8 cut(s)	145, 213, 330, 429, 581, 726, 738, 772
BstMWI	GCNNNNNNNGC	5 cut(s)	285, 392, 788, 797, 806
BstNI	CCWGG	1 cut(s)	171
BstSCI	CCNGG	1 cut(s)	169
BstV1I	GCAGC	4 cut(s)	288, 407, 745, 791
BstV2I	GAAGAC	1 cut(s)	24
BstX2I	RGATCY	4 cut(s)	213, 330, 429, 726
BstYI	RGATCY	4 cut(s)	213, 330, 429, 726
Bsu15I	ATCGAT	1 cut(s)	60
BsuRI	GGCC	4 cut(s)	169, 542, 719, 800
BsuTUI	ATCGAT	1 cut(s)	60
BtgI	CCRYGG	1 cut(s)	513
BtsCI	GGATG	1 cut(s)	230
BtsIMutI	CAGTG	4 cut(s)	135, 228, 783, 931
CaiI	CAGNNNCTG	1 cut(s)	785
CciI	TCATGA	1 cut(s)	825
Cfr13I	GGNCC	3 cut(s)	541, 718, 877
ClaI	ATCGAT	1 cut(s)	60
Csp6I	GTAC	1 cut(s)	862
CspCI	CAANNNNNGTGG	4 cut(s)	124, 146, 159, 181
CviAII	CATG	3 cut(s)	31, 514, 826
CviQI	GTAC	1 cut(s)	862
DdeI	CTNAG	5 cut(s)	40, 201, 423, 507, 793
DpnI	GATC	8 cut(s)	147, 215, 332, 431, 583, 728, 740, 774
DpnII	GATC	8 cut(s)	145, 213, 330, 429, 581, 726, 738, 772
EaeI	YGGCCR	1 cut(s)	167
Eam1104I	CTCTTC	1 cut(s)	855
EarI	CTCTTC	1 cut(s)	855
EciI	GGCGGA	1 cut(s)	890
Eco130I	CCWWGG	3 cut(s)	513, 721, 810
Eco31I	GGTCTC	1 cut(s)	102
Eco47I	GGWCC	1 cut(s)	877
Eco57I	CTGAAG	1 cut(s)	734
EcoNI	CCTNNNNNAGG	1 cut(s)	869
EcoRII	CCWGG	1 cut(s)	169
EcoT14I	CCWWGG	3 cut(s)	513, 721, 810
ErhI	CCWWGG	3 cut(s)	513, 721, 810
FaeI	CATG	3 cut(s)	34, 517, 829
FalI	AAGNNNNNCTT	2 cut(s)	897, 929
FaqI	GGGAC	2 cut(s)	484, 589
FatI	CATG	3 cut(s)	30, 513, 825
FbaI	TGATCA	1 cut(s)	772
Fnu4HI	GCNGC	5 cut(s)	277, 396, 540, 759, 780
FokI	GGATG	1 cut(s)	237
Fsp4HI	GCNGC	5 cut(s)	277, 396, 540, 759, 780
FspBI	CTAG	4 cut(s)	407, 488, 659, 947
GluI	GCNGC	5 cut(s)	277, 396, 540, 759, 780
HaeIII	GGCC	4 cut(s)	169, 542, 719, 800
Hin1II	CATG	3 cut(s)	34, 517, 829
HinfI	GANTC	6 cut(s)	47, 518, 577, 829, 845, 929
Hpy188I	TCNGA	3 cut(s)	367, 424, 743
Hpy188III	TCNNGA	7 cut(s)	328, 334, 374, 456, 599, 826, 941
Hpy99I	CGWCG	3 cut(s)	26, 29, 549
HpyAV	CCTTC	5 cut(s)	5, 461, 595, 596, 709
HpyCH4III	ACNGT	2 cut(s)	232, 383
HpyCH4IV	ACGT	2 cut(s)	547, 699
HpyCH4V	TGCA	7 cut(s)	209, 220, 228, 276, 288, 477, 556
HpyF10VI	GCNNNNNNNGC	5 cut(s)	285, 392, 788, 797, 806
HpyF3I	CTNAG	5 cut(s)	40, 201, 423, 507, 793
HpySE526I	ACGT	2 cut(s)	547, 699
Hsp92II	CATG	3 cut(s)	34, 517, 829
Ksp22I	TGATCA	1 cut(s)	772
Kzo9I	GATC	8 cut(s)	145, 213, 330, 429, 581, 726, 738, 772
Lsp1109I	GCAGC	4 cut(s)	288, 407, 745, 791
LweI	GCATC	4 cut(s)	215, 368, 543, 778
MaeI	CTAG	4 cut(s)	407, 488, 659, 947
MaeII	ACGT	2 cut(s)	547, 699
MaeIII	GTNAC	1 cut(s)	695
MalI	GATC	8 cut(s)	147, 215, 332, 431, 583, 728, 740, 774
MboI	GATC	8 cut(s)	145, 213, 330, 429, 581, 726, 738, 772
MboII	GAAGA	5 cut(s)	29, 329, 354, 842, 917
MfeI	CAATTG	1 cut(s)	158
MflI	RGATCY	4 cut(s)	213, 330, 429, 726
MhlI	GDGCHC	1 cut(s)	327
MlsI	TGGCCA	1 cut(s)	169
MluCI	AATT	5 cut(s)	67, 158, 418, 479, 566
MluNI	TGGCCA	1 cut(s)	169
MlyI	GAGTC	3 cut(s)	571, 854, 938
MnlI	CCTC	6 cut(s)	131, 452, 610, 790, 865, 875
Mox20I	TGGCCA	1 cut(s)	169
MscI	TGGCCA	1 cut(s)	169
MseI	TTAA	3 cut(s)	302, 882, 970
MslI	CAYNNNNRTG	1 cut(s)	824
Msp20I	TGGCCA	1 cut(s)	169
MspA1I	CMGCKG	2 cut(s)	76, 398
MspR9I	CCNGG	1 cut(s)	171
MunI	CAATTG	1 cut(s)	158
Mva1269I	GAATGC	2 cut(s)	211, 811
MvaI	CCWGG	1 cut(s)	171
MwoI	GCNNNNNNNGC	5 cut(s)	285, 392, 788, 797, 806
NcoI	CCATGG	1 cut(s)	513
NdeII	GATC	8 cut(s)	145, 213, 330, 429, 581, 726, 738, 772
NlaIII	CATG	3 cut(s)	34, 517, 829
NmuCI	GTSAC	1 cut(s)	695
PagI	TCATGA	1 cut(s)	825
PctI	GAATGC	2 cut(s)	211, 811
PfeI	GAWTC	3 cut(s)	47, 518, 829
PkrI	GCNGC	5 cut(s)	278, 397, 541, 760, 781
PleI	GAGTC	3 cut(s)	571, 853, 937
PpsI	GAGTC	3 cut(s)	571, 853, 937
Psp6I	CCWGG	1 cut(s)	169
PspGI	CCWGG	1 cut(s)	169
PspPI	GGNCC	3 cut(s)	541, 718, 877
PstNI	CAGNNNCTG	1 cut(s)	785
PsuI	RGATCY	4 cut(s)	213, 330, 429, 726
PvuII	CAGCTG	1 cut(s)	76
RsaI	GTAC	1 cut(s)	863
RsaNI	GTAC	1 cut(s)	862
RseI	CAYNNNNRTG	1 cut(s)	824
SaqAI	TTAA	3 cut(s)	302, 882, 970
SatI	GCNGC	5 cut(s)	277, 396, 540, 759, 780
Sau3AI	GATC	8 cut(s)	145, 213, 330, 429, 581, 726, 738, 772
Sau96I	GGNCC	3 cut(s)	541, 718, 877
SchI	GAGTC	3 cut(s)	571, 854, 938
ScrFI	CCNGG	1 cut(s)	171
SduI	GDGCHC	1 cut(s)	327
SfaNI	GCATC	4 cut(s)	215, 368, 543, 778
SinI	GGWCC	1 cut(s)	877
SmiMI	CAYNNNNRTG	1 cut(s)	824
SmlI	CTYRAG	2 cut(s)	99, 326
SmoI	CTYRAG	2 cut(s)	99, 326
Sse9I	AATT	5 cut(s)	67, 158, 418, 479, 566
SsiI	CCGC	3 cut(s)	398, 539, 875
SspMI	CTAG	4 cut(s)	407, 488, 659, 947
StyD4I	CCNGG	1 cut(s)	169
StyI	CCWWGG	3 cut(s)	513, 721, 810
TaaI	ACNGT	2 cut(s)	232, 383
TaiI	ACGT	2 cut(s)	550, 702
TaqI	TCGA	3 cut(s)	60, 580, 600
TasI	AATT	5 cut(s)	67, 158, 418, 479, 566
TauI	GCSGC	1 cut(s)	542
TfiI	GAWTC	3 cut(s)	47, 518, 829
Tru1I	TTAA	3 cut(s)	302, 882, 970
Tru9I	TTAA	3 cut(s)	302, 882, 970
TscAI	CASTG	4 cut(s)	142, 235, 790, 931
TseFI	GTSAC	1 cut(s)	695
TseI	GCWGC	4 cut(s)	276, 395, 758, 779
Tsp45I	GTSAC	1 cut(s)	695
TspDTI	ATGAA	8 cut(s)	46, 330, 472, 510, 579, 641, 821, 968
TspRI	CASTG	4 cut(s)	142, 235, 790, 931
VpaK11BI	GGWCC	1 cut(s)	877
XagI	CCTNNNNNAGG	1 cut(s)	869
XapI	RAATTY	2 cut(s)	418, 479
XcmI	CCANNNNNNNNNTGG	1 cut(s)	520
XspI	CTAG	4 cut(s)	407, 488, 659, 947

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.