Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010810.1

Orthogroup ID

OG0002345

Physical Location & Seq

Genomic Coordinates Forward (+)

3785 .. 5829

Gene Structure 2045 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010810.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 990 bp

atggactgttgtcagactcttagtcatctaaaaggttctttgtgctgtcagttattattattctttatctggttatccagttttcaagatgctgtggcattggagacggtctttgagcagagtcatgttcctcaaatgccagagcttgctaaaccaccttctagtggaatctttggtcctatagaaatatcacctgcagttattccacattatccagatcctgacgaaccctttccgccgatgtaccctacatttccaaccagatatgagcctgttttaactgggaaatgtcctgtcaatttctccgctatatcgagtatcattgaaaaaacagcatctgattgttcagaacctttggcagcacttgtaggaaatgtaatatgttgtccacagttcagtagtttgatccgcatcttccagggtctctacagcttcaactcggctaagttggttttgcaagattcagttgcaagtgattgttttacagatataatcagtatcttagccagtaggggtgcaaacagtacaatacctacactttgctctgtaaaatcttcaaatcttactggtgggtcctgtccagtgaaggatgttgatacctttgaaaaaacagtaaacacaagcagattactggaggcctgcatagctgttgatcctcttaaagagtgctgccgaccaatttgtcaacctgcaatcatggatgctgcgcttcagatctccgggaagcaactgcagttggatgagaataaaaatttggttggtgagccgaatcatatcgacactccaagtgactgtaaaggagtggtttttgcatatctttcaaggaaactctcgtcagatgttgtaaatactgcatttcgaatattatcggcctgcaaagttaataaaggtacagtgttaaaatatgttatgaccagttttgatttggctttatgtactttggtttggtatctgtcttcttgtaagaccctttcttaccattgttgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

329

Amino Acids

35.78

Weight (kDa)

5.4

Isoelectric Point (pI)

49.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002345)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G30700 AT2G30700
fragaria_vesca	FvH4_4g10670 FvH4_4g10670 FvH4_4g10670 FvH4_4g10670
malus_domestica	MD03G1229900.v1.1 MD11G1250400.v1.1
prunus_persica	Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1
pyrus_communis	pycom03g17750 pycom11g22160
rosa_chinensis	RchiOBHm_Chr4g0406321
rosa_laevigata	RLG00000008775
rosa_multiflora	Rmu_sc0003452.1_g000013 Rmu_sc0010810.1_g000001
rosa_roxburghii	Rroxscaffold_5G00351050
rosa_rugosa	Rorug04G0068700 Rorug04G0068800 Rorug04G0068900 Rorug04G0069000 Rorug04G0069100
rosa_samantha	Rh4AG137300 Rh4AG137500 Rh4BG134900 Rh4CG145500 Rh4DG131700
rosa_wichuraiana	Rw4G011110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	202
AasI	GACNNNNNNGTC	1 cut(s)	681
Acc36I	ACCTGC	2 cut(s)	202, 697
AciI	CCGC	3 cut(s)	236, 306, 409
AclWI	GGATC	3 cut(s)	212, 400, 647
AcsI	RAATTY	1 cut(s)	751
AcuI	CTGAAG	1 cut(s)	695
AfaI	GTAC	4 cut(s)	245, 526, 892, 937
AfiI	CCNNNNNNNGG	1 cut(s)	164
AgsI	TTSAA	6 cut(s)	86, 326, 436, 558, 605, 822
AhdI	GACNNNNNGTC	1 cut(s)	21
AjnI	CCWGG	1 cut(s)	417
AjuI	GAANNNNNNNTTGG	2 cut(s)	737, 769
AluBI	AGCT	3 cut(s)	145, 432, 647
AluI	AGCT	3 cut(s)	145, 432, 647
Alw26I	GTCTC	2 cut(s)	98, 428
AlwI	GGATC	3 cut(s)	212, 400, 647
AlwNI	CAGNNNCTG	2 cut(s)	221, 338
AoxI	GGCC	2 cut(s)	636, 870
ApeKI	GCWGC	3 cut(s)	359, 669, 704
ApoI	RAATTY	1 cut(s)	751
Asp700I	GAANNNNTTC	1 cut(s)	231
AspLEI	GCGC	1 cut(s)	709
AspS9I	GGNCC	2 cut(s)	176, 573
AsuC2I	CCSGG	1 cut(s)	721
AsuHPI	GGTGA	2 cut(s)	183, 773
AsuII	TTCGAA	1 cut(s)	859
AvaII	GGWCC	2 cut(s)	176, 573
BbsI	GAAGAC	1 cut(s)	948
BbvI	GCAGC	3 cut(s)	371, 656, 691
BciT130I	CCWGG	1 cut(s)	419
BcnI	CCSGG	1 cut(s)	721
BcoDI	GTCTC	2 cut(s)	98, 428
BfaI	CTAG	1 cut(s)	162
BfmI	CTRYAG	4 cut(s)	180, 195, 427, 731
BfuAI	ACCTGC	2 cut(s)	202, 697
BglII	AGATCT	1 cut(s)	714
BisI	GCNGC	3 cut(s)	360, 670, 705
BlsI	GCNGC	3 cut(s)	361, 671, 706
Bme1390I	CCNGG	2 cut(s)	419, 721
Bme18I	GGWCC	2 cut(s)	176, 573
BmeRI	GACNNNNNGTC	1 cut(s)	21
BmgT120I	GGNCC	2 cut(s)	176, 573
BmiI	GGNNCC	1 cut(s)	574
BmrFI	CCNGG	2 cut(s)	419, 721
BmrI	ACTGGG	1 cut(s)	291
BmsI	GCATC	4 cut(s)	79, 344, 420, 691
BmuI	ACTGGG	1 cut(s)	291
BoxI	GACNNNNGTC	1 cut(s)	9
BpiI	GAAGAC	1 cut(s)	948
BpmI	CTGGAG	1 cut(s)	653
Bpu14I	TTCGAA	1 cut(s)	859
BpuMI	CCSGG	1 cut(s)	721
BsaBI	GATNNNNATC	1 cut(s)	410
BsaI	GGTCTC	1 cut(s)	428
BsaJI	CCNNGG	1 cut(s)	418
Bsc4I	CCNNNNNNNGG	1 cut(s)	164
Bse1I	ACTGG	7 cut(s)	78, 286, 507, 571, 581, 636, 915
Bse8I	GATNNNNATC	1 cut(s)	410
BseBI	CCWGG	1 cut(s)	419
BseDI	CCNNGG	1 cut(s)	418
BseGI	GGATG	3 cut(s)	595, 706, 745
BseJI	GATNNNNATC	1 cut(s)	410
BseLI	CCNNNNNNNGG	1 cut(s)	164
BseNI	ACTGG	7 cut(s)	78, 286, 507, 571, 581, 636, 915
BseXI	GCAGC	3 cut(s)	371, 656, 691
BshFI	GGCC	2 cut(s)	638, 872
BsiSI	CCGG	1 cut(s)	720
BslI	CCNNNNNNNGG	1 cut(s)	164
BsmAI	GTCTC	2 cut(s)	98, 428
BsmBI	CGTCTC	1 cut(s)	98
BsnI	GGCC	2 cut(s)	638, 872
Bso31I	GGTCTC	1 cut(s)	428
Bsp119I	TTCGAA	1 cut(s)	859
Bsp143I	GATC	4 cut(s)	217, 405, 652, 714
BspACI	CCGC	3 cut(s)	236, 306, 409
BspANI	GGCC	2 cut(s)	638, 872
BspLI	GGNNCC	1 cut(s)	574
BspMAI	CTGCAG	2 cut(s)	199, 735
BspMI	ACCTGC	2 cut(s)	202, 697
BspPI	GGATC	3 cut(s)	212, 400, 647
BspT104I	TTCGAA	1 cut(s)	859
BspTNI	GGTCTC	1 cut(s)	428
BsrI	ACTGG	7 cut(s)	78, 286, 507, 571, 581, 636, 915
BssECI	CCNNGG	1 cut(s)	418
BssMI	GATC	4 cut(s)	217, 405, 652, 714
Bst2UI	CCWGG	1 cut(s)	419
Bst4CI	ACNGT	7 cut(s)	8, 109, 393, 524, 613, 794, 895
BstBI	TTCGAA	1 cut(s)	859
BstC8I	GCNNGC	3 cut(s)	147, 640, 874
BstDEI	CTNAG	3 cut(s)	20, 444, 502
BstF5I	GGATG	3 cut(s)	595, 706, 745
BstHHI	GCGC	1 cut(s)	709
BstKTI	GATC	4 cut(s)	220, 408, 655, 717
BstMAI	GTCTC	2 cut(s)	98, 428
BstMBI	GATC	4 cut(s)	217, 405, 652, 714
BstMWI	GCNNNNNNNGC	1 cut(s)	644
BstNI	CCWGG	1 cut(s)	419
BstPAI	GACNNNNGTC	1 cut(s)	9
BstSCI	CCNGG	2 cut(s)	417, 719
BstSFI	CTRYAG	4 cut(s)	180, 195, 427, 731
BstV1I	GCAGC	3 cut(s)	371, 656, 691
BstV2I	GAAGAC	1 cut(s)	948
BstX2I	RGATCY	2 cut(s)	217, 714
BstYI	RGATCY	2 cut(s)	217, 714
BsuRI	GGCC	2 cut(s)	638, 872
BtsCI	GGATG	3 cut(s)	595, 706, 745
BtsIMutI	CAGTG	2 cut(s)	588, 900
BveI	ACCTGC	2 cut(s)	202, 697
Cac8I	GCNNGC	3 cut(s)	147, 640, 874
CaiI	CAGNNNCTG	2 cut(s)	221, 338
CfoI	GCGC	1 cut(s)	709
Cfr13I	GGNCC	2 cut(s)	176, 573
Csp6I	GTAC	4 cut(s)	244, 525, 891, 936
CviAII	CATG	2 cut(s)	125, 697
CviQI	GTAC	4 cut(s)	244, 525, 891, 936
DdeI	CTNAG	3 cut(s)	20, 444, 502
DpnI	GATC	4 cut(s)	219, 407, 654, 716
DpnII	GATC	4 cut(s)	217, 405, 652, 714
DrdI	GACNNNNNNGTC	1 cut(s)	681
DriI	GACNNNNNGTC	1 cut(s)	21
DseDI	GACNNNNNNGTC	1 cut(s)	681
Eam1105I	GACNNNNNGTC	1 cut(s)	21
EciI	GGCGGA	1 cut(s)	225
Eco147I	AGGCCT	1 cut(s)	638
Eco31I	GGTCTC	1 cut(s)	428
Eco47I	GGWCC	2 cut(s)	176, 573
Eco57I	CTGAAG	1 cut(s)	695
EcoO109I	RGGNCCY	1 cut(s)	573
EcoRII	CCWGG	1 cut(s)	417
Esp3I	CGTCTC	1 cut(s)	98
FaeI	CATG	2 cut(s)	128, 700
FatI	CATG	2 cut(s)	124, 696
Fnu4HI	GCNGC	3 cut(s)	360, 670, 705
FokI	GGATG	3 cut(s)	602, 713, 752
Fsp4HI	GCNGC	3 cut(s)	360, 670, 705
FspBI	CTAG	1 cut(s)	162
GlaI	GCGC	1 cut(s)	708
GluI	GCNGC	3 cut(s)	360, 670, 705
GsuI	CTGGAG	1 cut(s)	653
HaeIII	GGCC	2 cut(s)	638, 872
HapII	CCGG	1 cut(s)	720
HhaI	GCGC	1 cut(s)	709
Hin1II	CATG	2 cut(s)	128, 700
Hin6I	GCGC	1 cut(s)	707
HinP1I	GCGC	1 cut(s)	707
HincII	GTYRAC	1 cut(s)	686
HindII	GTYRAC	1 cut(s)	686
HinfI	GANTC	5 cut(s)	16, 121, 168, 461, 769
HpaII	CCGG	1 cut(s)	720
HphI	GGTGA	2 cut(s)	183, 773
Hpy166II	GTNNAC	3 cut(s)	389, 616, 686
Hpy188I	TCNGA	5 cut(s)	15, 340, 349, 714, 838
Hpy188III	TCNNGA	3 cut(s)	86, 215, 221
Hpy8I	GTNNAC	3 cut(s)	389, 616, 686
HpyAV	CCTTC	2 cut(s)	168, 580
HpyCH4III	ACNGT	7 cut(s)	8, 109, 393, 524, 613, 794, 895
HpyF10VI	GCNNNNNNNGC	1 cut(s)	644
HpyF3I	CTNAG	3 cut(s)	20, 444, 502
Hsp92II	CATG	2 cut(s)	128, 700
HspAI	GCGC	1 cut(s)	707
Kzo9I	GATC	4 cut(s)	217, 405, 652, 714
Lsp1109I	GCAGC	3 cut(s)	371, 656, 691
LweI	GCATC	4 cut(s)	79, 344, 420, 691
MaeI	CTAG	1 cut(s)	162
MaeIII	GTNAC	1 cut(s)	788
MalI	GATC	4 cut(s)	219, 407, 654, 716
MboI	GATC	4 cut(s)	217, 405, 652, 714
MboII	GAAGA	3 cut(s)	406, 546, 948
MflI	RGATCY	2 cut(s)	217, 714
MluCI	AATT	3 cut(s)	298, 678, 751
MlyI	GAGTC	2 cut(s)	10, 130
MmeI	TCCRAC	2 cut(s)	281, 717
MnlI	CCTC	3 cut(s)	141, 628, 666
MroXI	GAANNNNTTC	1 cut(s)	231
MseI	TTAA	4 cut(s)	278, 660, 882, 899
MspI	CCGG	1 cut(s)	720
MspR9I	CCNGG	2 cut(s)	419, 721
MvaI	CCWGG	1 cut(s)	419
MwoI	GCNNNNNNNGC	1 cut(s)	644
NciI	CCSGG	1 cut(s)	721
NdeII	GATC	4 cut(s)	217, 405, 652, 714
NlaIII	CATG	2 cut(s)	128, 700
NlaIV	GGNNCC	1 cut(s)	574
NmeAIII	GCCGAG	1 cut(s)	419
NmuCI	GTSAC	1 cut(s)	788
NspV	TTCGAA	1 cut(s)	859
PaqCI	CACCTGC	1 cut(s)	202
PceI	AGGCCT	1 cut(s)	638
PdmI	GAANNNNTTC	1 cut(s)	231
PfeI	GAWTC	3 cut(s)	168, 461, 769
PfoI	TCCNGGA	1 cut(s)	719
PkrI	GCNGC	3 cut(s)	361, 671, 706
PleI	GAGTC	2 cut(s)	10, 129
PpsI	GAGTC	2 cut(s)	10, 129
PpuMI	RGGWCCY	1 cut(s)	573
PshAI	GACNNNNGTC	1 cut(s)	9
Psp5II	RGGWCCY	1 cut(s)	573
Psp6I	CCWGG	1 cut(s)	417
PspGI	CCWGG	1 cut(s)	417
PspN4I	GGNNCC	1 cut(s)	574
PspPI	GGNCC	2 cut(s)	176, 573
PspPPI	RGGWCCY	1 cut(s)	573
PstI	CTGCAG	2 cut(s)	199, 735
PstNI	CAGNNNCTG	2 cut(s)	221, 338
PsuI	RGATCY	2 cut(s)	217, 714
RsaI	GTAC	4 cut(s)	245, 526, 892, 937
RsaNI	GTAC	4 cut(s)	244, 525, 891, 936
SaqAI	TTAA	4 cut(s)	278, 660, 882, 899
SatI	GCNGC	3 cut(s)	360, 670, 705
Sau3AI	GATC	4 cut(s)	217, 405, 652, 714
Sau96I	GGNCC	2 cut(s)	176, 573
SchI	GAGTC	2 cut(s)	10, 130
ScrFI	CCNGG	2 cut(s)	419, 721
SfaNI	GCATC	4 cut(s)	79, 344, 420, 691
SfcI	CTRYAG	4 cut(s)	180, 195, 427, 731
SfuI	TTCGAA	1 cut(s)	859
SinI	GGWCC	2 cut(s)	176, 573
Sse9I	AATT	3 cut(s)	298, 678, 751
SseBI	AGGCCT	1 cut(s)	638
SsiI	CCGC	3 cut(s)	236, 306, 409
SspI	AATATT	1 cut(s)	864
SspMI	CTAG	1 cut(s)	162
StuI	AGGCCT	1 cut(s)	638
StyD4I	CCNGG	2 cut(s)	417, 719
TaaI	ACNGT	7 cut(s)	8, 109, 393, 524, 613, 794, 895
TaqI	TCGA	3 cut(s)	314, 777, 859
TasI	AATT	3 cut(s)	298, 678, 751
TatI	WGTACW	2 cut(s)	524, 935
TfiI	GAWTC	3 cut(s)	168, 461, 769
Tru1I	TTAA	4 cut(s)	278, 660, 882, 899
Tru9I	TTAA	4 cut(s)	278, 660, 882, 899
TscAI	CASTG	2 cut(s)	588, 900
TseFI	GTSAC	1 cut(s)	788
TseI	GCWGC	3 cut(s)	359, 669, 704
Tsp45I	GTSAC	1 cut(s)	788
TspRI	CASTG	2 cut(s)	588, 900
VpaK11BI	GGWCC	2 cut(s)	176, 573
XapI	RAATTY	1 cut(s)	751
XcmI	CCANNNNNNNNNTGG	1 cut(s)	922
XmnI	GAANNNNTTC	1 cut(s)	231
XspI	CTAG	1 cut(s)	162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.