Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000004

Orthogroup ID

OG0002345

Physical Location & Seq

Genomic Coordinates Reverse (-)

10728199 .. 10730043

Gene Structure 1845 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug04G0069000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 654 bp

ATGCCATCGATCTCTGTTGCTGAAGGAGCAAAGAAGGCCAATAAGATTGAAGAGATGAATAAACAAAATATTAGAGCCAGCTCAATCCCTCCACCTCGTGCTGTCTTATCCAGTCCTGACAATGATACGGTGATTGGAAACAAAAATAGGATCAAAGCACAACGACCATCTGCTCTGAAGAATCATAGCTTGGTTCAGAATAGAACTTGTGCTTTGTTTATGGGGAAAGATGTTTCACACAAGGACATGAAAGTTTTGCAAAATTTTGCTACTATTGTAGAATGTATCTTCTGCTATGGTATTCTTGACTTTCTCCCTCTTTTCCTCTATGATATCCATCTGAAATGCTCTCCACCTAGCAAAGCACTGGATTTTACAGCTGTTAAGGATATAGGACTGGAAAGTAAAAACAATCCTAATTTAGGATTGGAATTCGATGACACTCCGTATCAAGATCTCAAAACTATAGGATTGAAGTTTGGTAACAATCCTGTTACGGGATTGAGAGGCAATAGTGGTCCAAAACTAGATAATATGCAGGTCTCTGCTCACATCAGTGCCAAAGCACAACCTTATGCTCCAAGACAGAGAACAGATAAGATTCCATCTGACTGGAGCAGTGGAGCAGACAAAGCGACAAGGAGGAGCCTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

217

Amino Acids

23.87

Weight (kDa)

9.43

Isoelectric Point (pI)

43.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002345)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G30700 AT2G30700
fragaria_vesca	FvH4_4g10670 FvH4_4g10670 FvH4_4g10670 FvH4_4g10670
malus_domestica	MD03G1229900.v1.1 MD11G1250400.v1.1
prunus_persica	Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.1G201300_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1 Prupe.4G179400_v2.0.a1
pyrus_communis	pycom03g17750 pycom11g22160
rosa_chinensis	RchiOBHm_Chr4g0406321
rosa_laevigata	RLG00000008775
rosa_multiflora	Rmu_sc0003452.1_g000013 Rmu_sc0010810.1_g000001
rosa_roxburghii	Rroxscaffold_5G00351050
rosa_rugosa	Rorug04G0068700 Rorug04G0068800 Rorug04G0068900 Rorug04G0069000 Rorug04G0069100
rosa_samantha	Rh4AG137300 Rh4AG137500 Rh4BG134900 Rh4CG145500 Rh4DG131700
rosa_wichuraiana	Rw4G011110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	529
AclWI	GGATC	1 cut(s)	158
AcsI	RAATTY	2 cut(s)	262, 431
AcuI	CTGAAG	2 cut(s)	42, 197
AdeI	CACNNNGTG	1 cut(s)	98
AfiI	CCNNNNNNNGG	2 cut(s)	422, 497
AgsI	TTSAA	2 cut(s)	50, 475
AjuI	GAANNNNNNNTTGG	2 cut(s)	173, 205
AleI	CACNNNNGTG	1 cut(s)	555
AluBI	AGCT	3 cut(s)	81, 189, 380
AluI	AGCT	3 cut(s)	81, 189, 380
Alw26I	GTCTC	1 cut(s)	547
AlwI	GGATC	1 cut(s)	158
AoxI	GGCC	1 cut(s)	36
ApoI	RAATTY	2 cut(s)	262, 431
AspS9I	GGNCC	1 cut(s)	518
AsuHPI	GGTGA	1 cut(s)	142
AvaII	GGWCC	1 cut(s)	518
BauI	CACGAG	1 cut(s)	96
BccI	CCATC	4 cut(s)	13, 175, 345, 613
BcoDI	GTCTC	1 cut(s)	547
BfaI	CTAG	2 cut(s)	357, 527
BfmI	CTRYAG	1 cut(s)	465
BfuAI	ACCTGC	1 cut(s)	529
BglII	AGATCT	1 cut(s)	454
Bme18I	GGWCC	1 cut(s)	518
BmgT120I	GGNCC	1 cut(s)	518
BmiI	GGNNCC	1 cut(s)	647
BpmI	CTGGAG	1 cut(s)	634
Bsa29I	ATCGAT	1 cut(s)	8
BsaBI	GATNNNNATC	1 cut(s)	336
BsaI	GGTCTC	1 cut(s)	547
Bsc4I	CCNNNNNNNGG	2 cut(s)	422, 497
Bse1I	ACTGG	4 cut(s)	111, 372, 402, 617
Bse8I	GATNNNNATC	1 cut(s)	336
BseCI	ATCGAT	1 cut(s)	8
BseJI	GATNNNNATC	1 cut(s)	336
BseLI	CCNNNNNNNGG	2 cut(s)	422, 497
BseNI	ACTGG	4 cut(s)	111, 372, 402, 617
BshFI	GGCC	1 cut(s)	38
BshVI	ATCGAT	1 cut(s)	8
BslI	CCNNNNNNNGG	2 cut(s)	422, 497
BsmAI	GTCTC	1 cut(s)	547
BsnI	GGCC	1 cut(s)	38
Bso31I	GGTCTC	1 cut(s)	547
Bsp143I	GATC	3 cut(s)	9, 150, 454
BspANI	GGCC	1 cut(s)	38
BspDI	ATCGAT	1 cut(s)	8
BspLI	GGNNCC	1 cut(s)	647
BspMI	ACCTGC	1 cut(s)	529
BspPI	GGATC	1 cut(s)	158
BspTNI	GGTCTC	1 cut(s)	547
BsrI	ACTGG	4 cut(s)	111, 372, 402, 617
BssMI	GATC	3 cut(s)	9, 150, 454
BssSI	CACGAG	1 cut(s)	96
Bst2BI	CACGAG	1 cut(s)	96
Bst4CI	ACNGT	1 cut(s)	130
Bst6I	CTCTTC	1 cut(s)	45
BstC8I	GCNNGC	1 cut(s)	79
BstENI	CCTNNNNNAGG	1 cut(s)	420
BstKTI	GATC	3 cut(s)	12, 153, 457
BstMAI	GTCTC	1 cut(s)	547
BstMBI	GATC	3 cut(s)	9, 150, 454
BstMWI	GCNNNNNNNGC	3 cut(s)	26, 35, 632
BstSFI	CTRYAG	1 cut(s)	465
BstX2I	RGATCY	1 cut(s)	454
BstXI	CCANNNNNNTGG	1 cut(s)	612
BstYI	RGATCY	1 cut(s)	454
Bsu15I	ATCGAT	1 cut(s)	8
BsuRI	GGCC	1 cut(s)	38
BsuTUI	ATCGAT	1 cut(s)	8
BtsI	GCAGTG	1 cut(s)	625
BtsIMutI	CAGTG	3 cut(s)	365, 562, 625
BveI	ACCTGC	1 cut(s)	529
Cac8I	GCNNGC	1 cut(s)	79
Cfr13I	GGNCC	1 cut(s)	518
ClaI	ATCGAT	1 cut(s)	8
CviAII	CATG	1 cut(s)	247
CviJI	RGCY	6 cut(s)	38, 77, 81, 189, 380, 648
CviKI_1	RGCY	6 cut(s)	38, 77, 81, 189, 380, 648
DpnI	GATC	3 cut(s)	11, 152, 456
DpnII	GATC	3 cut(s)	9, 150, 454
DraIII	CACNNNGTG	1 cut(s)	98
Eam1104I	CTCTTC	1 cut(s)	45
EarI	CTCTTC	1 cut(s)	45
Eco31I	GGTCTC	1 cut(s)	547
Eco32I	GATATC	1 cut(s)	334
Eco47I	GGWCC	1 cut(s)	518
Eco57I	CTGAAG	2 cut(s)	42, 197
EcoNI	CCTNNNNNAGG	1 cut(s)	420
EcoRI	GAATTC	1 cut(s)	431
EcoRV	GATATC	1 cut(s)	334
FaeI	CATG	1 cut(s)	250
FaiI	YATR	9 cut(s)	186, 221, 248, 297, 330, 392, 467, 536, 576
FatI	CATG	1 cut(s)	246
FspBI	CTAG	2 cut(s)	357, 527
GsuI	CTGGAG	1 cut(s)	634
HaeIII	GGCC	1 cut(s)	38
Hin1II	CATG	1 cut(s)	250
HinfI	GANTC	2 cut(s)	181, 601
HphI	GGTGA	1 cut(s)	142
Hpy188I	TCNGA	4 cut(s)	177, 198, 342, 610
Hpy188III	TCNNGA	3 cut(s)	116, 305, 452
HpyAV	CCTTC	2 cut(s)	17, 28
HpyCH4III	ACNGT	1 cut(s)	130
HpyCH4V	TGCA	2 cut(s)	259, 538
HpyF10VI	GCNNNNNNNGC	3 cut(s)	26, 35, 632
Hsp92II	CATG	1 cut(s)	250
Kzo9I	GATC	3 cut(s)	9, 150, 454
LmnI	GCTCC	5 cut(s)	26, 583, 615, 623, 645
LpnPI	CCDG	8 cut(s)	91, 124, 129, 353, 383, 504, 524, 598
MaeI	CTAG	2 cut(s)	357, 527
MaeIII	GTNAC	2 cut(s)	482, 493
MalI	GATC	3 cut(s)	11, 152, 456
MboI	GATC	3 cut(s)	9, 150, 454
MboII	GAAGA	3 cut(s)	62, 190, 280
MflI	RGATCY	1 cut(s)	454
MluCI	AATT	3 cut(s)	262, 418, 431
MnlI	CCTC	6 cut(s)	99, 105, 327, 335, 500, 636
MseI	TTAA	1 cut(s)	384
MslI	CAYNNNNRTG	1 cut(s)	555
MspA1I	CMGCKG	1 cut(s)	380
MwoI	GCNNNNNNNGC	3 cut(s)	26, 35, 632
NdeII	GATC	3 cut(s)	9, 150, 454
NlaIII	CATG	1 cut(s)	250
NlaIV	GGNNCC	1 cut(s)	647
OliI	CACNNNNGTG	1 cut(s)	555
PfeI	GAWTC	2 cut(s)	181, 601
PspN4I	GGNNCC	1 cut(s)	647
PspPI	GGNCC	1 cut(s)	518
PsuI	RGATCY	1 cut(s)	454
PvuII	CAGCTG	1 cut(s)	380
RseI	CAYNNNNRTG	1 cut(s)	555
SaqAI	TTAA	1 cut(s)	384
Sau3AI	GATC	3 cut(s)	9, 150, 454
Sau96I	GGNCC	1 cut(s)	518
SetI	ASST	7 cut(s)	83, 97, 191, 358, 382, 543, 574
SfcI	CTRYAG	1 cut(s)	465
SinI	GGWCC	1 cut(s)	518
SmiMI	CAYNNNNRTG	1 cut(s)	555
Sse9I	AATT	3 cut(s)	262, 418, 431
SspI	AATATT	1 cut(s)	70
SspMI	CTAG	2 cut(s)	357, 527
TaaI	ACNGT	1 cut(s)	130
TaqI	TCGA	2 cut(s)	8, 435
TasI	AATT	3 cut(s)	262, 418, 431
TfiI	GAWTC	2 cut(s)	181, 601
Tru1I	TTAA	1 cut(s)	384
Tru9I	TTAA	1 cut(s)	384
TscAI	CASTG	3 cut(s)	372, 562, 625
TspDTI	ATGAA	2 cut(s)	71, 263
TspGWI	ACGGA	1 cut(s)	435
TspRI	CASTG	3 cut(s)	372, 562, 625
VpaK11BI	GGWCC	1 cut(s)	518
XagI	CCTNNNNNAGG	1 cut(s)	420
XapI	RAATTY	2 cut(s)	262, 431
XspI	CTAG	2 cut(s)	357, 527

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.