Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011709.1

Orthogroup ID

OG0003903

Physical Location & Seq

Genomic Coordinates Forward (+)

2114 .. 12418

Gene Structure 10305 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011709.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 5226 bp

atgggtagaaggaagcaaagccggcctcaccggtcaggtgggattgtattagagagtcaagcaactgctggcaggggagaattggatgaggggaggcttttaaatggagaaacgcaaaagaatgacatagatgaagttgatagaccgtattttgtggaagttgatcggtctaattggggatcagatgagcaccttgatattgctgaagtggttttaacagatttgaccttcagagaagggttttgcagtgatgtttttagtgggggtttgaattgcgatagttactccttaaggttccggttatctaatgtaaaggagttcattggtcgtattaagcttggtcattggcctttgttgtcctctgctgatctatctttggaattcgttaaaacatgttcaagcgagtatatggacatggacaaggacacctgctcagtaatcttgtcagggagttttgatggaccagatgaaggtatttctggtctggtacacttggcaagtttgaagtttatgacactgaggccagctctgtccattgggtttgtgaatgatacgtcaaccatcagggtcagggtggagatacttaagagtgcatttaatgcttgtgagtcacttcttgacaatactaggcaagtgtggaaaaagagtatgatgaatgtcatggcttggctacacccagaagtagtgacttccgaggctaggtatggagtcagtagatcaacagacatggagattgattcgcatactgacactggacatgctaattccaatcatagtaaacatgcaaggtttgatgttgctgggttctatgaagccattaaaccctcaaaagcagatacaatgcttcaagatgtcctgcctgatttgcttcctgaattgaaaccatatcaacgccgtgcagcttactggatggtacagagggagaaaagcgatgcacaaagtctggcccaagaggccacaagtcagttcatgtcgcccttatgtttgcccttgcaatttctcgacagatgttcaaaaatgttctacaacccattcagtggaaatgtttcgctgcaccaagagcatttttcaacgtacgtctctggtggtattcttgctgatgagatgggcatggggaaaactgttgaacttctcgcttgcatctttgctcatcagaagtcagcagatgaagaccccatatttgctgatgctgaaattcaagatactgaggatctgaaaataaagcttaaaagattaaaaagggagcgagttgaatgtatatgtggagctgtgagtgaaagtatcagatacagaggactatgggtacagtgcgacatatgtgatgcatggcaacatgccgattgtgtgggctattcacctagaggaaaggctataaaatccaacgaggcttctaatgaaaaagaacatgataagagttcggtggttaagaattatactagaaagaagaatacagccacaatagatgtgagagatgaggaatatatatgccagctgtgctcagaactgatacaggccactacttctcctgttgctactggtgccactcttattgattgtgtgggctattcacctagaggaaagactataaaatccaacgagacttctaacgaaaaagaacatgataagagttcggtggttaagaattatactagaaagaagaatacagccacaatagatgtgagagatgaggaatatatatgccagctgtgctcagaactgatacaggccactacttctcctgttgctactggtgccactcttataatctgtccagcttctatattgccccagtggtattctgaaattatgcgccatacgcgttcaggttctttaaagacttgcgtctatgaaggtgtaagagaggcatctttttcaaacacatctgtaattgatatcagtgaactcatcagtgctgacattgtgttgacaacatatgatgtgcttaaagcggacctgtcacatgactctgataggcatgaaggtgatcgacgcttaatgagattccaaaagagataccctgttgttccaactattcttaccagaatattctggtggagaatttgtttggatgaggctcagatggtggagagtaatgctggtgctgcaacagaaatggctatgcgactgtatgcaaagcatcgttggtgcataacggggactcctatacaacgtaaacttgatgacttgtatggacttctacggtttcttaaagcaagccctttcaatgcttccaggtggtggattgaagttatacgagatccatatgagaggagagatgcaggagctatggaatttacacataaattctttaaagaaatcatgtggcgatcttcaaaggtgcatgttgcagatgagttgcagcttccacctcaggaagaatgtctctcttggctcactttatctccagttgaagagcatttttaccagaggcaacatgaaacttgtgtgagttatgcccgagaagtcattgaacatatgaaagatgatattatgaagagaaaagtcagaggatgctcagcagctaaatcatcagattctttcatcacacatgcggaggcaggaaagctgctgaacacacttctgaagcttcgccaagccagctgtcaccctcaagtaggaagctcaggactgcgttctctccaacagtctcccatgactatggaggaaatattaatggttcttgtaagtaaaaccaagatagaaggagaggaagctctcagaaggttagttgttgctcttaatgggctcgctgggatagctgtaattgagcaaaattttactcaagctgtatcactgtataaggaatcgttgactttagctgaagagcacactgaggatttccgcctggatcctttgttgaatattcacattcatcataatcttgccgaaatacttccattagcaacaagctgctccccttcaaaaggacaacatattcctggaaaaatgggcccctgtgatgaatatgtagcaaagaggcgaaaactgggtggggaagataactcatcagagaatgacgtatctaatgctcaagaatataataactcccatgcatcatgtagttccttcactgacgtatctttgagaacagtctgtgacaatcttaaacaaaagtacttatctgcattcagttcaaagttattcatgactcagcaagagtttaagaagtcttacacccaggtttgtagcacaattagtgagatcaaagatgtaagtacagtctggtggctggaagcccttcttcatgctgaaaagaataatgacatttctagtctgttgatcagaaagattgaagaggcgctcataggaactctaaacaattcaaagtcatctagaattccatctcgtttacgaagcataagcgctctaaagtatcacatgcagaccggtttggaccaactagaagaatctaggaaactgttacttgatcgacttttagaaattgatcagacaatggaaaagccaaaagaggaggatatccagcgtgtgagatactgtcgaaattgcaaagctaatgatggtggtcccttatgtgttctttgtgaagtagatgaattatttcggggatatgaagcaaggctctttcgtcttgagaaaatatctggagggattgctacctctgctgaagaggctgtggatttgcagaagaagaactctgaacttaatcgtttctatcagaatttatcacagccaattaaggattcaacgtcatccaaatctaatcaagaatcgaagaagagagatgttggaaaagttgtggtttcaaaatccccatctgaattagaggttgttcttggagttataaaaagccattgcaaggcccatttaggaaaggaaggtatatcagaagctaccaagcacctacacattcttgagggcatgcgcaaggagtatggccatgcaagatccttggcaatagctcaagctcagattctgcaagcttatgatgaaattaatatggcaactacaaggttgcgcctgagtgaagatgagaatgataaatctcttgatgtattaagtgaagatgaattaccttcagctaacgttttatacaccagtgaaaagttcgcatccttgagcttgttgtcttgcataaaagggaagcttcgttatttgaagggtttggtagaagctaaacaaaaaatgccatttggatgtccaaatcattcctcagtaactggagaggaagccaccatatcgacttctacagaacagagaaatgaatgtgtacctacaggtgataaagaaacgtgcccagtttgtcaagaacagttaaccattcaaaagatggttttcccttgtggacatcttacttgctgtaaatgtttatttgcaattactgagaaactactaaatgggaaaaaggttcaagataagtgggtaaaatgcccaacatgtcgacagcacactgatgttgcagatattgcttttgctgatgatggacaaagtgaatcttgtggttctgctgggcttcatgcaatccaaagtcgtgaagagtgtgaagcatctattatagttcaaggttcatatggaacaaagattgaagcagttacaagaagaattctgtggataaagtctaccgatccagaggctaaagttcttgttttctcaagctggaatgatgtccttgacgtattggagcatgccttcattgctaatggcattacctttataaggatgaaaggaggaaggaaatcacaagttgccattagtgaatttaaaggagaaaagagaagcttaacaggaaatcacaagttgcatggccgaaacccagaaggaagatctattcaagtgttgctgctcttaattcaacatggagcgaatggcctcaatctgttggaagcgaagcatgttattcttgttgagccgcttctcaatccagcagcagaagcacaagccatcggcagggtacaccgtatcggacagaaaaataagaccctcgctcatcgtttcatagttaaaggcacggttgaagagagcatatacaagctcaacaaaagcaggaacagcactgccttcattagtggtaacacaaaaaaccaagatcagcccttattgacactgaaagacattgaggccttattttcaacagtgccatcattacctgtaccagagactgatgtaaggccaactgaaagtgaaactctaagacatttgccaccttctgtggctgctgccattgcagctgagaagcggctcaaggagcagcattcatgttcttcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000209 GO:0003674 GO:0003824 GO:0004842 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0006464 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0009987 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0019899 GO:0031625 GO:0031974 GO:0031981 GO:0032446 GO:0033554 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044389 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0050896 GO:0051716 GO:0061630 GO:0061659 GO:0070013 GO:0070647 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Helicase_C PHD SNF2_N zf-C3HC4

Protein Analysis

1741

Amino Acids

195.21

Weight (kDa)

6.47

Isoelectric Point (pI)

44.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003903)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G40770 AT2G40770 AT2G40770
fragaria_vesca	FvH4_7g26110 FvH4_7g26110 FvH4_7g26110 FvH4_7g26110 FvH4_7g26110 FvH4_7g26110
malus_domestica	MD01G1169300.v1.1
prunus_persica	Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1 Prupe.2G265500_v2.0.a1
pyrus_communis	pycom01g18200
rosa_chinensis	RchiOBHm_Chr1g0372551
rosa_laevigata	RLG00000026892
rosa_multiflora	Rmu_sc0005410.1_g000019 Rmu_sc0011709.1_g000002
rosa_roxburghii	Rroxscaffold_4G00284860
rosa_rugosa	Rorug01G0372700
rosa_samantha	Rh1AG381200 Rh1BG344600 Rh1CG358000 Rh1DG375800
rosa_wichuraiana	Rw1G033520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	3 cut(s)	1763, 3803, 4673
AarI	CACCTGC	1 cut(s)	437
Acc16I	TGCGCA	1 cut(s)	3884
Acc36I	ACCTGC	1 cut(s)	437
AccB1I	GGYRCC	2 cut(s)	1538, 1751
AccB7I	CCANNNNNTGG	2 cut(s)	1037, 2238
AccI	GTMKAC	2 cut(s)	4399, 4577
AccII	CGCG	1 cut(s)	1819
AciI	CCGC	5 cut(s)	1949, 2552, 2842, 4868, 5194
AclI	AACGTT	1 cut(s)	4044
AclWI	GGATC	7 cut(s)	187, 1218, 2252, 2843, 2856, 3900, 4577
AcoI	YGGCCR	2 cut(s)	3895, 4762
AcuI	CTGAAG	6 cut(s)	214, 225, 2603, 2841, 3645, 4020
AfaI	GTAC	9 cut(s)	489, 915, 1076, 1305, 3116, 3217, 4230, 4911, 5109
AfeI	AGCGCT	1 cut(s)	3364
AfiI	CCNNNNNNNGG	9 cut(s)	470, 699, 1037, 2238, 2615, 2924, 3817, 4674, 4905
AflII	CTTAAG	2 cut(s)	289, 584
AflIII	ACRYGT	3 cut(s)	392, 1817, 4394
AgeI	ACCGGT	2 cut(s)	30, 3386
AjnI	CCWGG	4 cut(s)	2231, 2844, 2938, 3177
AjuI	GAANNNNNNNTTGG	2 cut(s)	3685, 3717
Alw21I	GWGCWC	4 cut(s)	192, 1499, 1712, 2829
Alw26I	GTCTC	5 cut(s)	1084, 1592, 2387, 2652, 5108
AlwI	GGATC	7 cut(s)	187, 1218, 2252, 2843, 2856, 3900, 4577
AlwNI	CAGNNNCTG	3 cut(s)	3934, 4178, 5117
Ama87I	CYCGRG	1 cut(s)	2457
Aor51HI	AGCGCT	1 cut(s)	3364
ApaI	GGGCCC	1 cut(s)	2954
ArsI	GACNNNNNNTTYG	2 cut(s)	1163, 1195
AseI	ATTAAT	2 cut(s)	2672, 3954
AsiGI	ACCGGT	2 cut(s)	30, 3386
Asp700I	GAANNNNTTC	4 cut(s)	1045, 2892, 3237, 3558
AspLEI	GCGC	5 cut(s)	1812, 3301, 3365, 3885, 3978
AspS9I	GGNCC	8 cut(s)	461, 946, 1951, 2950, 2951, 3394, 3524, 3820
AsuHPI	GGTGA	6 cut(s)	20, 1347, 1560, 1994, 2597, 4250
AvaI	CYCGRG	1 cut(s)	2457
AvaII	GGWCC	4 cut(s)	461, 1951, 3394, 3524
AxyI	CCTNAGG	1 cut(s)	2370
BaeGI	GKGCMC	2 cut(s)	2954, 4256
BaeI	ACNNNNGTAYC	2 cut(s)	3060, 3093
BalI	TGGCCA	1 cut(s)	3897
BamHI	GGATCC	1 cut(s)	2848
BanI	GGYRCC	2 cut(s)	1538, 1751
BanII	GRGCYC	2 cut(s)	2748, 2954
BarI	GAAGNNNNNNTAC	2 cut(s)	4014, 4046
BbsI	GAAGAC	1 cut(s)	1176
Bbv12I	GWGCWC	4 cut(s)	192, 1499, 1712, 2829
BceAI	ACGGC	1 cut(s)	879
BciT130I	CCWGG	4 cut(s)	2233, 2846, 2940, 3179
BclI	TGATCA	2 cut(s)	3279, 3445
BcoDI	GTCTC	5 cut(s)	1084, 1592, 2387, 2652, 5108
BfmI	CTRYAG	2 cut(s)	4206, 4233
BfoI	RGCGCY	2 cut(s)	3302, 3366
BfrI	CTTAAG	2 cut(s)	289, 584
BfuAI	ACCTGC	1 cut(s)	437
BglI	GCCNNNNNGGC	1 cut(s)	953
BglII	AGATCT	1 cut(s)	4781
BlpI	GCTNAGC	1 cut(s)	2515
BmcAI	AGTACT	1 cut(s)	3116
Bme1390I	CCNGG	4 cut(s)	2233, 2846, 2940, 3179
Bme18I	GGWCC	4 cut(s)	461, 1951, 3394, 3524
BmeT110I	CYCGRG	1 cut(s)	2457
BmgT120I	GGNCC	8 cut(s)	461, 946, 1951, 2950, 2951, 3394, 3524, 3820
BmiI	GGNNCC	7 cut(s)	296, 1540, 1753, 2850, 2952, 2953, 3526
BmrFI	CCNGG	4 cut(s)	2233, 2846, 2940, 3179
BmrI	ACTGGG	3 cut(s)	1783, 2996, 4250
BmuI	ACTGGG	3 cut(s)	1783, 2996, 4250
BoxI	GACNNNNGTC	1 cut(s)	1841
BpiI	GAAGAC	1 cut(s)	1176
BplI	GAGNNNNNCTC	2 cut(s)	511, 543
BpmI	CTGGAG	3 cut(s)	2388, 3624, 4200
Bpu10I	CCTNAGC	1 cut(s)	2623
Bpu1102I	GCTNAGC	1 cut(s)	2515
BpuEI	CTTGAG	9 cut(s)	2595, 2766, 3015, 3611, 3893, 3906, 4096, 4594, 5183
BsaJI	CCNNGG	3 cut(s)	693, 3177, 3909
BsaWI	WCCGGW	3 cut(s)	30, 297, 3386
Bsc4I	CCNNNNNNNGG	9 cut(s)	470, 699, 1037, 2238, 2615, 2924, 3817, 4674, 4905
Bse118I	RCCGGY	3 cut(s)	21, 30, 3386
Bse21I	CCTNAGG	1 cut(s)	2370
Bse3DI	GCAATG	3 cut(s)	3811, 4650, 5178
BseBI	CCWGG	4 cut(s)	2233, 2846, 2940, 3179
BseDI	CCNNGG	3 cut(s)	693, 3177, 3909
BseGI	GGATG	8 cut(s)	91, 915, 2074, 2516, 3710, 4070, 4160, 4683
BseLI	CCNNNNNNNGG	9 cut(s)	470, 699, 1037, 2238, 2615, 2924, 3817, 4674, 4905
BseMI	GCAATG	3 cut(s)	3811, 4650, 5178
BseRI	GAGGAG	2 cut(s)	2284, 3485
BseSI	GKGCMC	2 cut(s)	2954, 4256
BseYI	CCCAGC	3 cut(s)	800, 2750, 4466
BsgI	GTGCAG	2 cut(s)	918, 1037
Bsh1236I	CGCG	1 cut(s)	1819
BshNI	GGYRCC	2 cut(s)	1538, 1751
BshTI	ACCGGT	2 cut(s)	30, 3386
BsiHKAI	GWGCWC	4 cut(s)	192, 1499, 1712, 2829
BsiHKCI	CYCGRG	1 cut(s)	2457
BsiSI	CCGG	4 cut(s)	22, 31, 298, 3387
BsiWI	CGTACG	1 cut(s)	1074
BslFI	GGGAC	2 cut(s)	2170, 3510
BslI	CCNNNNNNNGG	9 cut(s)	470, 699, 1037, 2238, 2615, 2924, 3817, 4674, 4905
BsmAI	GTCTC	5 cut(s)	1084, 1592, 2387, 2652, 5108
BsmBI	CGTCTC	1 cut(s)	1084
BsmFI	GGGAC	2 cut(s)	2170, 3510
BsmI	GAATGC	2 cut(s)	3125, 5209
BsoBI	CYCGRG	1 cut(s)	2457
Bsp120I	GGGCCC	1 cut(s)	2950
Bsp1286I	GDGCHC	7 cut(s)	192, 1499, 1712, 2748, 2829, 2954, 4256
Bsp1720I	GCTNAGC	1 cut(s)	2515
BspACI	CCGC	5 cut(s)	1949, 2552, 2842, 4868, 5194
BspFNI	CGCG	1 cut(s)	1819
BspHI	TCATGA	2 cut(s)	3144, 5222
BspLI	GGNNCC	7 cut(s)	296, 1540, 1753, 2850, 2952, 2953, 3526
BspMI	ACCTGC	1 cut(s)	437
BspPI	GGATC	7 cut(s)	187, 1218, 2252, 2843, 2856, 3900, 4577
BspQI	GCTCTTC	2 cut(s)	2406, 2817
BspT107I	GGYRCC	2 cut(s)	1538, 1751
BspTI	CTTAAG	2 cut(s)	289, 584
BsrDI	GCAATG	3 cut(s)	3811, 4650, 5178
BsrFI	RCCGGY	3 cut(s)	21, 30, 3386
BssAI	RCCGGY	3 cut(s)	21, 30, 3386
BssECI	CCNNGG	3 cut(s)	693, 3177, 3909
BssT1I	CCWWGG	1 cut(s)	3909
Bst2UI	CCWGG	4 cut(s)	2233, 2846, 2940, 3179
Bst6I	CTCTTC	8 cut(s)	2406, 2489, 2817, 3288, 3621, 3731, 4488, 4968
BstAFI	CTTAAG	2 cut(s)	289, 584
BstAPI	GCANNNNNTGC	2 cut(s)	599, 4424
BstENI	CCTNNNNNAGG	3 cut(s)	2613, 2922, 4672
BstF5I	GGATG	8 cut(s)	91, 915, 2074, 2516, 3710, 4070, 4160, 4683
BstFNI	CGCG	1 cut(s)	1819
BstH2I	RGCGCY	2 cut(s)	3302, 3366
BstHHI	GCGC	5 cut(s)	1812, 3301, 3365, 3885, 3978
BstMAI	GTCTC	5 cut(s)	1084, 1592, 2387, 2652, 5108
BstNI	CCWGG	4 cut(s)	2233, 2846, 2940, 3179
BstPAI	GACNNNNGTC	1 cut(s)	1841
BstSCI	CCNGG	4 cut(s)	2231, 2844, 2938, 3177
BstSFI	CTRYAG	2 cut(s)	4206, 4233
BstSLI	GKGCMC	2 cut(s)	2954, 4256
BstUI	CGCG	1 cut(s)	1819
BstV2I	GAAGAC	1 cut(s)	1176
BstX2I	RGATCY	5 cut(s)	1210, 2257, 2848, 3905, 4781
BstXI	CCANNNNNNTGG	1 cut(s)	2659
BstYI	RGATCY	5 cut(s)	1210, 2257, 2848, 3905, 4781
Bsu36I	CCTNAGG	1 cut(s)	2370
BtgZI	GCGATG	1 cut(s)	945
BtsCI	GGATG	8 cut(s)	91, 915, 2074, 2516, 3710, 4070, 4160, 4683
BtsI	GCAGTG	2 cut(s)	253, 5010
BveI	ACCTGC	1 cut(s)	437
CaiI	CAGNNNCTG	3 cut(s)	3934, 4178, 5117
CciI	TCATGA	2 cut(s)	3144, 5222
CfoI	GCGC	5 cut(s)	1812, 3301, 3365, 3885, 3978
Cfr10I	RCCGGY	3 cut(s)	21, 30, 3386
Cfr13I	GGNCC	8 cut(s)	461, 946, 1951, 2950, 2951, 3394, 3524, 3820
CseI	GACGC	2 cut(s)	1831, 1998
Csp6I	GTAC	9 cut(s)	488, 914, 1075, 1304, 3115, 3216, 4229, 4910, 5108
CspAI	ACCGGT	2 cut(s)	30, 3386
CspCI	CAANNNNNGTGG	4 cut(s)	1531, 1566, 4358, 4393
CviQI	GTAC	9 cut(s)	488, 914, 1075, 1304, 3115, 3216, 4229, 4910, 5108
DraI	TTTAAA	4 cut(s)	102, 1833, 2311, 4720
EaeI	YGGCCR	2 cut(s)	3895, 4762
Eam1104I	CTCTTC	8 cut(s)	2406, 2489, 2817, 3288, 3621, 3731, 4488, 4968
EarI	CTCTTC	8 cut(s)	2406, 2489, 2817, 3288, 3621, 3731, 4488, 4968
EciI	GGCGGA	1 cut(s)	2831
Eco130I	CCWWGG	1 cut(s)	3909
Eco147I	AGGCCT	1 cut(s)	5078
Eco24I	GRGCYC	2 cut(s)	2748, 2954
Eco32I	GATATC	2 cut(s)	1894, 3478
Eco47I	GGWCC	4 cut(s)	461, 1951, 3394, 3524
Eco47III	AGCGCT	1 cut(s)	3364
Eco57I	CTGAAG	6 cut(s)	214, 225, 2603, 2841, 3645, 4020
Eco81I	CCTNAGG	1 cut(s)	2370
Eco88I	CYCGRG	1 cut(s)	2457
EcoNI	CCTNNNNNAGG	3 cut(s)	2613, 2922, 4672
EcoO109I	RGGNCCY	1 cut(s)	2951
EcoRI	GAATTC	3 cut(s)	380, 3336, 4560
EcoRII	CCWGG	4 cut(s)	2231, 2844, 2938, 3177
EcoRV	GATATC	2 cut(s)	1894, 3478
EcoT14I	CCWWGG	1 cut(s)	3909
EcoT22I	ATGCAT	2 cut(s)	1327, 3055
EcoT38I	GRGCYC	2 cut(s)	2748, 2954
ErhI	CCWWGG	1 cut(s)	3909
Esp3I	CGTCTC	1 cut(s)	1084
FalI	AAGNNNNNCTT	8 cut(s)	3225, 3257, 4089, 4121, 4438, 4470, 4721, 4753
FaqI	GGGAC	2 cut(s)	2170, 3510
FauNDI	CATATG	5 cut(s)	1316, 1933, 2263, 2475, 4528
FbaI	TGATCA	2 cut(s)	3279, 3445
FblI	GTMKAC	2 cut(s)	4399, 4577
FokI	GGATG	8 cut(s)	98, 922, 2081, 2523, 3697, 4057, 4167, 4690
FriOI	GRGCYC	2 cut(s)	2748, 2954
FspI	TGCGCA	1 cut(s)	3884
GlaI	GCGC	5 cut(s)	1811, 3300, 3364, 3884, 3977
GsaI	CCCAGC	3 cut(s)	804, 2754, 4470
GsuI	CTGGAG	3 cut(s)	2388, 3624, 4200
HaeII	RGCGCY	2 cut(s)	3302, 3366
HapII	CCGG	4 cut(s)	22, 31, 298, 3387
HgaI	GACGC	2 cut(s)	1831, 1998
HhaI	GCGC	5 cut(s)	1812, 3301, 3365, 3885, 3978
Hin6I	GCGC	5 cut(s)	1810, 3299, 3363, 3883, 3976
HinP1I	GCGC	5 cut(s)	1810, 3299, 3363, 3883, 3976
HincII	GTYRAC	5 cut(s)	558, 1926, 2811, 4275, 4400
HindII	GTYRAC	5 cut(s)	558, 1926, 2811, 4275, 4400
HindIII	AAGCTT	6 cut(s)	335, 1223, 2585, 3939, 4103, 4735
HpaI	GTTAAC	1 cut(s)	4275
HpaII	CCGG	4 cut(s)	22, 31, 298, 3387
HphI	GGTGA	6 cut(s)	20, 1347, 1560, 1994, 2597, 4250
Hpy99I	CGWCG	1 cut(s)	1992
HspAI	GCGC	5 cut(s)	1810, 3299, 3363, 3883, 3976
KroI	GCCGGC	1 cut(s)	21
KroNI	GCCGGC	1 cut(s)	23
Ksp22I	TGATCA	2 cut(s)	3279, 3445
KspAI	GTTAAC	1 cut(s)	4275
LguI	GCTCTTC	2 cut(s)	2406, 2817
LmnI	GCTCC	7 cut(s)	1243, 1265, 2282, 2918, 4639, 4817, 5203
MflI	RGATCY	5 cut(s)	1210, 2257, 2848, 3905, 4781
MhlI	GDGCHC	7 cut(s)	192, 1499, 1712, 2748, 2829, 2954, 4256
MlsI	TGGCCA	1 cut(s)	3897
MluI	ACGCGT	1 cut(s)	1817
MluNI	TGGCCA	1 cut(s)	3897
MlyI	GAGTC	6 cut(s)	64, 617, 717, 1958, 2152, 3142
MmeI	TCCRAC	6 cut(s)	1404, 1617, 2051, 2665, 3727, 4818
Mox20I	TGGCCA	1 cut(s)	3897
Mph1103I	ATGCAT	2 cut(s)	1327, 3055
MroNI	GCCGGC	1 cut(s)	21
MroXI	GAANNNNTTC	4 cut(s)	1045, 2892, 3237, 3558
MscI	TGGCCA	1 cut(s)	3897
MslI	CAYNNNNRTG	4 cut(s)	1980, 2657, 4153, 4410
Msp20I	TGGCCA	1 cut(s)	3897
MspA1I	CMGCKG	4 cut(s)	1492, 1705, 2601, 5186
MspCI	CTTAAG	2 cut(s)	289, 584
MspI	CCGG	4 cut(s)	22, 31, 298, 3387
MspR9I	CCNGG	4 cut(s)	2233, 2846, 2940, 3179
Mva1269I	GAATGC	2 cut(s)	3125, 5209
MvaI	CCWGG	4 cut(s)	2233, 2846, 2940, 3179
MvnI	CGCG	1 cut(s)	1819
NaeI	GCCGGC	1 cut(s)	23
NdeI	CATATG	5 cut(s)	1316, 1933, 2263, 2475, 4528
NgoMIV	GCCGGC	1 cut(s)	21
NlaIV	GGNNCC	7 cut(s)	296, 1540, 1753, 2850, 2952, 2953, 3526
NmuCI	GTSAC	5 cut(s)	609, 685, 1956, 2603, 3095
NsbI	TGCGCA	1 cut(s)	3884
NsiI	ATGCAT	2 cut(s)	1327, 3055
PaeI	GCATGC	2 cut(s)	3883, 4646
PagI	TCATGA	2 cut(s)	3144, 5222
PaqCI	CACCTGC	1 cut(s)	437
PceI	AGGCCT	1 cut(s)	5078
PciI	ACATGT	2 cut(s)	392, 4394
PciSI	GCTCTTC	2 cut(s)	2406, 2817
PctI	GAATGC	2 cut(s)	3125, 5209
PdiI	GCCGGC	1 cut(s)	23
PdmI	GAANNNNTTC	4 cut(s)	1045, 2892, 3237, 3558
PfeI	GAWTC	9 cut(s)	737, 2001, 2534, 2804, 3407, 3701, 3728, 3931, 4451
Pfl23II	CGTACG	1 cut(s)	1074
PflMI	CCANNNNNTGG	2 cut(s)	1037, 2238
PfoI	TCCNGGA	1 cut(s)	2938
PinAI	ACCGGT	2 cut(s)	30, 3386
PleI	GAGTC	6 cut(s)	63, 616, 716, 1958, 2152, 3142
PpsI	GAGTC	6 cut(s)	63, 616, 716, 1958, 2152, 3142
PscI	ACATGT	2 cut(s)	392, 4394
PshAI	GACNNNNGTC	1 cut(s)	1841
PshBI	ATTAAT	2 cut(s)	2672, 3954
PsiI	TTATAA	3 cut(s)	1763, 3803, 4673
Psp1406I	AACGTT	1 cut(s)	4044
Psp6I	CCWGG	4 cut(s)	2231, 2844, 2938, 3177
PspFI	CCCAGC	3 cut(s)	800, 2750, 4466
PspGI	CCWGG	4 cut(s)	2231, 2844, 2938, 3177
PspLI	CGTACG	1 cut(s)	1074
PspN4I	GGNNCC	7 cut(s)	296, 1540, 1753, 2850, 2952, 2953, 3526
PspOMI	GGGCCC	1 cut(s)	2950
PspPI	GGNCC	8 cut(s)	461, 946, 1951, 2950, 2951, 3394, 3524, 3820
PstNI	CAGNNNCTG	3 cut(s)	3934, 4178, 5117
PsuI	RGATCY	5 cut(s)	1210, 2257, 2848, 3905, 4781
PvuII	CAGCTG	4 cut(s)	1492, 1705, 2601, 5186
RsaI	GTAC	9 cut(s)	489, 915, 1076, 1305, 3116, 3217, 4230, 4911, 5109
RsaNI	GTAC	9 cut(s)	488, 914, 1075, 1304, 3115, 3216, 4229, 4910, 5108
RseI	CAYNNNNRTG	4 cut(s)	1980, 2657, 4153, 4410
SalI	GTCGAC	1 cut(s)	4398
SapI	GCTCTTC	2 cut(s)	2406, 2817
Sau96I	GGNCC	8 cut(s)	461, 946, 1951, 2950, 2951, 3394, 3524, 3820
ScaI	AGTACT	1 cut(s)	3116
SchI	GAGTC	6 cut(s)	64, 617, 717, 1958, 2152, 3142
ScrFI	CCNGG	4 cut(s)	2233, 2846, 2940, 3179
SduI	GDGCHC	7 cut(s)	192, 1499, 1712, 2748, 2829, 2954, 4256
SfcI	CTRYAG	2 cut(s)	4206, 4233
SfiI	GGCCNNNNNGGCC	1 cut(s)	953
SinI	GGWCC	4 cut(s)	461, 1951, 3394, 3524
SmiMI	CAYNNNNRTG	4 cut(s)	1980, 2657, 4153, 4410
SphI	GCATGC	2 cut(s)	3883, 4646
SseBI	AGGCCT	1 cut(s)	5078
SsiI	CCGC	5 cut(s)	1949, 2552, 2842, 4868, 5194
SspI	AATATT	3 cut(s)	2046, 2670, 2863
StuI	AGGCCT	1 cut(s)	5078
StyD4I	CCNGG	4 cut(s)	2231, 2844, 2938, 3177
StyI	CCWWGG	1 cut(s)	3909
TaqI	TCGA	7 cut(s)	1002, 1987, 3430, 3499, 3731, 4199, 4399
TaqII	GACCGA	1 cut(s)	156
TatI	WGTACW	2 cut(s)	3114, 3215
TauI	GCSGC	2 cut(s)	4870, 5197
TfiI	GAWTC	9 cut(s)	737, 2001, 2534, 2804, 3407, 3701, 3728, 3931, 4451
TseFI	GTSAC	5 cut(s)	609, 685, 1956, 2603, 3095
Tsp45I	GTSAC	5 cut(s)	609, 685, 1956, 2603, 3095
Van91I	CCANNNNNTGG	2 cut(s)	1037, 2238
Vha464I	CTTAAG	2 cut(s)	289, 584
VpaK11BI	GGWCC	4 cut(s)	461, 1951, 3394, 3524
VspI	ATTAAT	2 cut(s)	2672, 3954
XagI	CCTNNNNNAGG	3 cut(s)	2613, 2922, 4672
XbaI	TCTAGA	1 cut(s)	3332
XcmI	CCANNNNNNNNNTGG	1 cut(s)	4285
XmiI	GTMKAC	2 cut(s)	4399, 4577
XmnI	GAANNNNTTC	4 cut(s)	1045, 2892, 3237, 3558
ZrmI	AGTACT	1 cut(s)	3116
Zsp2I	ATGCAT	2 cut(s)	1327, 3055

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.