Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012403.1

Orthogroup ID

OG0006188

Physical Location & Seq

Genomic Coordinates Forward (+)

56663 .. 64643

Gene Structure 7981 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012403.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1017 bp

atgtctctaacattctctcaaacactggtcctctattcctcagacccacctcacacttgtctcaattcaattcggaagctttcgccaacattctacagaaatggcagcaactctgtttctcgcagaaacaacagatttcagttccatgcaaactccactgactcagacgacgaattgggaactaggcaagttgctgccgtttccaacccatcatccaccagccttctctcttttctttgccccttgctcaaactcttctccggaggagatccctcacaagaacggaactttaccttggaggtagccacatcttccttgtctaccttggctagattcccttggggatcaagatctctatccaataattcggacagccaggaagtcactaccttggatcctcctctgcgtctgcagctttttgaattcgaggcctgccctttttgcaggagggttcgtgaagctatgactgagctagatctttcagcagaggtgtatccttgtccaaaaggttcgataagacacagagaattggttaacagatctggtggaaaagagcaatttccttttctcattgatccaaataccggtttttcaatgtatgaaagcggtgaaatcgtgagatacctattccagcaatatgggaaaggcagaaaaccttcaccagggcttttggaaagtacattgcttacagggtggatgccgacaatatttcgagcagggagaggaatgacattatgggaaagggctactgtagagccaccacctgaaaagctggaactttactcgtacgaaaataatccgtatgcacgaattgtgcgtgaggcactttgtgagttggagcttccttacatcctacagaatgtaggagaagggtccctgcggttaaagctgcttgttgatgcatcggggtccaaagaggttccctacttgattgatcccaacactggtactcatgttggtgactacaagaagatcctgtcctacttgttccagacatattcagtagccgctgtatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04110 ko04111 ko04113 ko04114 ko04120 ko04914 ko05166 map04110 map04111 map04113 map04114 map04120 map04914 map05166

Pfam Domains

Protein Families

GST_N_3

Protein Analysis

338

Amino Acids

37.94

Weight (kDa)

6.47

Isoelectric Point (pI)

44.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006188)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G10000 AT4G10000
fragaria_vesca	FvH4_5g33030 FvH4_5g33030 FvH4_5g33030 FvH4_5g33030 FvH4_5g33030 FvH4_5g33030 FvH4_5g33030
malus_domestica	MD15G1399300.v1.1
prunus_persica	Prupe.1G546800_v2.0.a1 Prupe.1G546800_v2.0.a1 Prupe.1G546800_v2.0.a1 Prupe.1G546800_v2.0.a1
pyrus_communis	pycom15g35830
rosa_chinensis	RchiOBHm_Chr7g0231111
rosa_laevigata	RLG00000001433
rosa_multiflora	Rmu_co8504477.1_g000001 Rmu_sc0012403.1_g000013
rosa_roxburghii	Rroxscaffold_3G00229480 Rroxscaffold_3G00229550
rosa_rugosa	Rorug07G0264700.1
rosa_samantha	Rh7AG417500 Rh7BG393700 Rh7CG437500 Rh7DG411500
rosa_wichuraiana	Rw7G034570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	320
AccIII	TCCGGA	1 cut(s)	260
AciI	CCGC	3 cut(s)	606, 880, 1008
AclWI	GGATC	7 cut(s)	263, 352, 389, 402, 569, 929, 967
AcsI	RAATTY	1 cut(s)	422
AdeI	CACNNNGTG	1 cut(s)	830
AfaI	GTAC	3 cut(s)	679, 788, 949
AfiI	CCNNNNNNNGG	3 cut(s)	584, 662, 944
AgeI	ACCGGT	1 cut(s)	584
AgsI	TTSAA	3 cut(s)	69, 422, 594
AjnI	CCWGG	2 cut(s)	375, 661
AjuI	GAANNNNNNNTTGG	2 cut(s)	278, 310
AluBI	AGCT	7 cut(s)	79, 415, 461, 472, 772, 841, 889
AluI	AGCT	7 cut(s)	79, 415, 461, 472, 772, 841, 889
Alw26I	GTCTC	2 cut(s)	9, 65
AlwI	GGATC	7 cut(s)	263, 352, 389, 402, 569, 929, 967
Aor13HI	TCCGGA	1 cut(s)	260
AoxI	GGCC	1 cut(s)	429
ApeKI	GCWGC	4 cut(s)	105, 194, 412, 889
ApoI	RAATTY	1 cut(s)	422
AsiGI	ACCGGT	1 cut(s)	584
Asp700I	GAANNNNTTC	1 cut(s)	655
AspS9I	GGNCC	3 cut(s)	28, 873, 909
AsuHPI	GGTGA	3 cut(s)	620, 651, 971
AvaII	GGWCC	3 cut(s)	28, 873, 909
BaeI	ACNNNNGTAYC	2 cut(s)	939, 972
BamHI	GGATCC	1 cut(s)	394
BbvI	GCAGC	4 cut(s)	117, 181, 424, 876
BccI	CCATC	1 cut(s)	217
BceAI	ACGGC	1 cut(s)	182
BciT130I	CCWGG	2 cut(s)	377, 663
BciVI	GTATCC	1 cut(s)	504
BcoDI	GTCTC	2 cut(s)	9, 65
BfaI	CTAG	3 cut(s)	183, 330, 473
BfmI	CTRYAG	4 cut(s)	94, 410, 750, 854
BfuI	GTATCC	1 cut(s)	504
BglII	AGATCT	3 cut(s)	350, 475, 539
BisI	GCNGC	5 cut(s)	106, 195, 413, 890, 1008
BlsI	GCNGC	5 cut(s)	107, 196, 414, 891, 1009
Bme1390I	CCNGG	2 cut(s)	377, 663
Bme18I	GGWCC	3 cut(s)	28, 873, 909
BmgT120I	GGNCC	3 cut(s)	28, 873, 909
BmiI	GGNNCC	5 cut(s)	396, 874, 875, 910, 921
BmrFI	CCNGG	2 cut(s)	377, 663
BmsI	GCATC	3 cut(s)	687, 889, 911
BsaBI	GATNNNNATC	2 cut(s)	349, 355
BsaJI	CCNNGG	5 cut(s)	294, 324, 338, 390, 662
BsaWI	WCCGGW	2 cut(s)	260, 584
BsaXI	ACNNNNNCTCC	2 cut(s)	439, 469
Bsc4I	CCNNNNNNNGG	3 cut(s)	584, 662, 944
Bse118I	RCCGGY	1 cut(s)	584
Bse1I	ACTGG	2 cut(s)	30, 949
Bse3DI	GCAATG	1 cut(s)	680
Bse8I	GATNNNNATC	2 cut(s)	349, 355
BseAI	TCCGGA	1 cut(s)	260
BseBI	CCWGG	2 cut(s)	377, 663
BseDI	CCNNGG	5 cut(s)	294, 324, 338, 390, 662
BseGI	GGATG	3 cut(s)	212, 702, 849
BseJI	GATNNNNATC	2 cut(s)	349, 355
BseLI	CCNNNNNNNGG	3 cut(s)	584, 662, 944
BseMI	GCAATG	1 cut(s)	680
BseMII	CTCAG	3 cut(s)	54, 177, 459
BseNI	ACTGG	2 cut(s)	30, 949
BseRI	GAGGAG	2 cut(s)	279, 390
BseXI	GCAGC	4 cut(s)	117, 181, 424, 876
BshFI	GGCC	1 cut(s)	431
BshTI	ACCGGT	1 cut(s)	584
BsiSI	CCGG	2 cut(s)	261, 585
BsiWI	CGTACG	1 cut(s)	786
BslFI	GGGAC	1 cut(s)	859
BslI	CCNNNNNNNGG	3 cut(s)	584, 662, 944
BsmAI	GTCTC	2 cut(s)	9, 65
BsmFI	GGGAC	1 cut(s)	859
BsnI	GGCC	1 cut(s)	431
Bsp13I	TCCGGA	1 cut(s)	260
Bsp143I	GATC	9 cut(s)	268, 344, 350, 394, 475, 539, 574, 934, 972
BspACI	CCGC	3 cut(s)	606, 880, 1008
BspANI	GGCC	1 cut(s)	431
BspCNI	CTCAG	3 cut(s)	53, 176, 460
BspEI	TCCGGA	1 cut(s)	260
BspLI	GGNNCC	5 cut(s)	396, 874, 875, 910, 921
BspMAI	CTGCAG	1 cut(s)	414
BspPI	GGATC	7 cut(s)	263, 352, 389, 402, 569, 929, 967
BsrDI	GCAATG	1 cut(s)	680
BsrFI	RCCGGY	1 cut(s)	584
BsrI	ACTGG	2 cut(s)	30, 949
BssAI	RCCGGY	1 cut(s)	584
BssECI	CCNNGG	5 cut(s)	294, 324, 338, 390, 662
BssMI	GATC	9 cut(s)	268, 344, 350, 394, 475, 539, 574, 934, 972
BssT1I	CCWWGG	4 cut(s)	294, 324, 338, 390
Bst2UI	CCWGG	2 cut(s)	377, 663
Bst4CI	ACNGT	1 cut(s)	751
Bst6I	CTCTTC	1 cut(s)	260
BstC8I	GCNNGC	1 cut(s)	433
BstDEI	CTNAG	3 cut(s)	40, 163, 468
BstENI	CCTNNNNNAGG	1 cut(s)	660
BstF5I	GGATG	3 cut(s)	212, 702, 849
BstKTI	GATC	9 cut(s)	271, 347, 353, 397, 478, 542, 577, 937, 975
BstMAI	GTCTC	2 cut(s)	9, 65
BstMBI	GATC	9 cut(s)	268, 344, 350, 394, 475, 539, 574, 934, 972
BstMWI	GCNNNNNNNGC	3 cut(s)	412, 441, 886
BstNI	CCWGG	2 cut(s)	377, 663
BstSCI	CCNGG	2 cut(s)	375, 661
BstSFI	CTRYAG	4 cut(s)	94, 410, 750, 854
BstV1I	GCAGC	4 cut(s)	117, 181, 424, 876
BstX2I	RGATCY	6 cut(s)	268, 350, 394, 475, 539, 972
BstXI	CCANNNNNNTGG	1 cut(s)	638
BstYI	RGATCY	6 cut(s)	268, 350, 394, 475, 539, 972
BsuI	GTATCC	1 cut(s)	504
BsuRI	GGCC	1 cut(s)	431
BtsCI	GGATG	3 cut(s)	212, 702, 849
BtsIMutI	CAGTG	3 cut(s)	23, 156, 942
Cac8I	GCNNGC	1 cut(s)	433
Cfr10I	RCCGGY	1 cut(s)	584
Cfr13I	GGNCC	3 cut(s)	28, 873, 909
CseI	GACGC	1 cut(s)	395
Csp6I	GTAC	3 cut(s)	678, 787, 948
CspAI	ACCGGT	1 cut(s)	584
CviAII	CATG	2 cut(s)	146, 953
CviQI	GTAC	3 cut(s)	678, 787, 948
DdeI	CTNAG	3 cut(s)	40, 163, 468
DpnI	GATC	9 cut(s)	270, 346, 352, 396, 477, 541, 576, 936, 974
DpnII	GATC	9 cut(s)	268, 344, 350, 394, 475, 539, 574, 934, 972
DraIII	CACNNNGTG	1 cut(s)	830
Eam1104I	CTCTTC	1 cut(s)	260
EarI	CTCTTC	1 cut(s)	260
Eco130I	CCWWGG	4 cut(s)	294, 324, 338, 390
Eco147I	AGGCCT	1 cut(s)	431
Eco47I	GGWCC	3 cut(s)	28, 873, 909
EcoNI	CCTNNNNNAGG	1 cut(s)	660
EcoO109I	RGGNCCY	1 cut(s)	873
EcoRI	GAATTC	1 cut(s)	422
EcoRII	CCWGG	2 cut(s)	375, 661
EcoT14I	CCWWGG	4 cut(s)	294, 324, 338, 390
EcoT22I	ATGCAT	1 cut(s)	904
ErhI	CCWWGG	4 cut(s)	294, 324, 338, 390
FaeI	CATG	2 cut(s)	149, 956
FaiI	YATR	9 cut(s)	147, 464, 600, 639, 736, 804, 954, 997, 1015
FaqI	GGGAC	1 cut(s)	859
FatI	CATG	2 cut(s)	145, 952
FblI	GTMKAC	1 cut(s)	320
Fnu4HI	GCNGC	5 cut(s)	106, 195, 413, 890, 1008
FokI	GGATG	3 cut(s)	199, 709, 836
Fsp4HI	GCNGC	5 cut(s)	106, 195, 413, 890, 1008
FspBI	CTAG	3 cut(s)	183, 330, 473
GluI	GCNGC	5 cut(s)	106, 195, 413, 890, 1008
HaeIII	GGCC	1 cut(s)	431
HapII	CCGG	2 cut(s)	261, 585
HgaI	GACGC	1 cut(s)	395
Hin1II	CATG	2 cut(s)	149, 956
HincII	GTYRAC	1 cut(s)	535
HindII	GTYRAC	1 cut(s)	535
HindIII	AAGCTT	1 cut(s)	77
HinfI	GANTC	2 cut(s)	161, 333
HpaI	GTTAAC	1 cut(s)	535
HpaII	CCGG	2 cut(s)	261, 585
HphI	GGTGA	3 cut(s)	620, 651, 971
Hpy166II	GTNNAC	2 cut(s)	321, 535
Hpy188I	TCNGA	4 cut(s)	43, 75, 166, 370
Hpy188III	TCNNGA	5 cut(s)	261, 348, 455, 616, 991
Hpy8I	GTNNAC	2 cut(s)	321, 535
Hpy99I	CGWCG	1 cut(s)	173
HpyAV	CCTTC	3 cut(s)	233, 666, 863
HpyCH4III	ACNGT	1 cut(s)	751
HpyCH4V	TGCA	5 cut(s)	149, 412, 444, 806, 902
HpyF10VI	GCNNNNNNNGC	3 cut(s)	412, 441, 886
HpyF3I	CTNAG	3 cut(s)	40, 163, 468
Hsp92II	CATG	2 cut(s)	149, 956
KflI	GGGWCCC	1 cut(s)	873
Kpn2I	TCCGGA	1 cut(s)	260
KspAI	GTTAAC	1 cut(s)	535
Kzo9I	GATC	9 cut(s)	268, 344, 350, 394, 475, 539, 574, 934, 972
LmnI	GCTCC	1 cut(s)	838
Lsp1109I	GCAGC	4 cut(s)	117, 181, 424, 876
LweI	GCATC	3 cut(s)	687, 889, 911
MaeI	CTAG	3 cut(s)	183, 330, 473
MaeIII	GTNAC	2 cut(s)	382, 959
MalI	GATC	9 cut(s)	270, 346, 352, 396, 477, 541, 576, 936, 974
MboI	GATC	9 cut(s)	268, 344, 350, 394, 475, 539, 574, 934, 972
MboII	GAAGA	3 cut(s)	247, 303, 982
MflI	RGATCY	6 cut(s)	268, 350, 394, 475, 539, 972
MluCI	AATT	8 cut(s)	64, 69, 173, 364, 422, 527, 557, 810
MlyI	GAGTC	1 cut(s)	155
MmeI	TCCRAC	2 cut(s)	228, 816
Mph1103I	ATGCAT	1 cut(s)	904
MroI	TCCGGA	1 cut(s)	260
MroXI	GAANNNNTTC	1 cut(s)	655
MseI	TTAA	2 cut(s)	534, 884
MslI	CAYNNNNRTG	1 cut(s)	957
MspA1I	CMGCKG	1 cut(s)	1010
MspI	CCGG	2 cut(s)	261, 585
MspR9I	CCNGG	2 cut(s)	377, 663
MvaI	CCWGG	2 cut(s)	377, 663
MwoI	GCNNNNNNNGC	3 cut(s)	412, 441, 886
NdeII	GATC	9 cut(s)	268, 344, 350, 394, 475, 539, 574, 934, 972
NlaIII	CATG	2 cut(s)	149, 956
NlaIV	GGNNCC	5 cut(s)	396, 874, 875, 910, 921
NmuCI	GTSAC	2 cut(s)	382, 959
NsiI	ATGCAT	1 cut(s)	904
PceI	AGGCCT	1 cut(s)	431
PcsI	WCGNNNNNNNCGW	1 cut(s)	814
PdmI	GAANNNNTTC	1 cut(s)	655
PfeI	GAWTC	1 cut(s)	333
Pfl23II	CGTACG	1 cut(s)	786
PinAI	ACCGGT	1 cut(s)	584
PkrI	GCNGC	5 cut(s)	107, 196, 414, 891, 1009
PleI	GAGTC	1 cut(s)	155
PpsI	GAGTC	1 cut(s)	155
PpuMI	RGGWCCY	1 cut(s)	873
Psp5II	RGGWCCY	1 cut(s)	873
Psp6I	CCWGG	2 cut(s)	375, 661
PspGI	CCWGG	2 cut(s)	375, 661
PspLI	CGTACG	1 cut(s)	786
PspN4I	GGNNCC	5 cut(s)	396, 874, 875, 910, 921
PspPI	GGNCC	3 cut(s)	28, 873, 909
PspPPI	RGGWCCY	1 cut(s)	873
PstI	CTGCAG	1 cut(s)	414
PsuI	RGATCY	6 cut(s)	268, 350, 394, 475, 539, 972
RsaI	GTAC	3 cut(s)	679, 788, 949
RsaNI	GTAC	3 cut(s)	678, 787, 948
RseI	CAYNNNNRTG	1 cut(s)	957
SaqAI	TTAA	2 cut(s)	534, 884
SatI	GCNGC	5 cut(s)	106, 195, 413, 890, 1008
Sau3AI	GATC	9 cut(s)	268, 344, 350, 394, 475, 539, 574, 934, 972
Sau96I	GGNCC	3 cut(s)	28, 873, 909
SchI	GAGTC	1 cut(s)	155
ScrFI	CCNGG	2 cut(s)	377, 663
SfaNI	GCATC	3 cut(s)	687, 889, 911
SfcI	CTRYAG	4 cut(s)	94, 410, 750, 854
SinI	GGWCC	3 cut(s)	28, 873, 909
SmiMI	CAYNNNNRTG	1 cut(s)	957
Sse9I	AATT	8 cut(s)	64, 69, 173, 364, 422, 527, 557, 810
SseBI	AGGCCT	1 cut(s)	431
SsiI	CCGC	3 cut(s)	606, 880, 1008
SspI	AATATT	1 cut(s)	708
SspMI	CTAG	3 cut(s)	183, 330, 473
StuI	AGGCCT	1 cut(s)	431
StyD4I	CCNGG	2 cut(s)	375, 661
StyI	CCWWGG	4 cut(s)	294, 324, 338, 390
TaaI	ACNGT	1 cut(s)	751
TaqI	TCGA	3 cut(s)	426, 512, 712
TasI	AATT	8 cut(s)	64, 69, 173, 364, 422, 527, 557, 810
TatI	WGTACW	1 cut(s)	677
TauI	GCSGC	1 cut(s)	1010
TfiI	GAWTC	1 cut(s)	333
Tru1I	TTAA	2 cut(s)	534, 884
Tru9I	TTAA	2 cut(s)	534, 884
TscAI	CASTG	3 cut(s)	30, 163, 949
TseFI	GTSAC	2 cut(s)	382, 959
TseI	GCWGC	4 cut(s)	105, 194, 412, 889
Tsp45I	GTSAC	2 cut(s)	382, 959
TspDTI	ATGAA	1 cut(s)	615
TspGWI	ACGGA	2 cut(s)	298, 789
TspRI	CASTG	3 cut(s)	30, 163, 949
VpaK11BI	GGWCC	3 cut(s)	28, 873, 909
XagI	CCTNNNNNAGG	1 cut(s)	660
XapI	RAATTY	1 cut(s)	422
XmiI	GTMKAC	1 cut(s)	320
XmnI	GAANNNNTTC	1 cut(s)	655
XspI	CTAG	3 cut(s)	183, 330, 473
Zsp2I	ATGCAT	1 cut(s)	904

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.