Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012713.1

Orthogroup ID

OG0004508

Physical Location & Seq

Genomic Coordinates Forward (+)

149 .. 2384

Gene Structure 2236 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012713.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 462 bp

atgtttttgcttaataatgtggttataaatgatgatgaaagtagggctgaggattcagatgatagcgaactagacttttcaagtcccctgcaagaacatggttctgtggagcgtttgtcaaatgttttttcaagagggaacagtcagatcaatcaacagactgaggattctcttgataactttcagaatcaaaatgaggcagagcctttagctggcagtactctggtaggtgaaagtaagagctttcgtcctaggcagtttgagtatcatccatccaactctagcattatggtctttggaacattagatggtgaaatagttgcagtcaaccatgagaatgggaaaattgtcagttatatcccatcactaggagcaatgaatagtgtgctgggactctgttggctcaagaagtatccctctaagctaatagctggttcagaacttcagataatggctcattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0000209 GO:0000715 GO:0003674 GO:0003676 GO:0003677 GO:0003684 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0006139 GO:0006259 GO:0006281 GO:0006289 GO:0006293 GO:0006294 GO:0006296 GO:0006325 GO:0006464 GO:0006508 GO:0006513 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0006996 GO:0008150 GO:0008152 GO:0009314 GO:0009411 GO:0009416 GO:0009628 GO:0009987 GO:0010390 GO:0016043 GO:0016567 GO:0016569 GO:0016570 GO:0016574 GO:0016579 GO:0019538 GO:0022607 GO:0030054 GO:0031334 GO:0031461 GO:0031465 GO:0031974 GO:0031981 GO:0032446 GO:0032991 GO:0033522 GO:0033554 GO:0033683 GO:0034622 GO:0034641 GO:0034644 GO:0035518 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043254 GO:0043412 GO:0043687 GO:0043933 GO:0044085 GO:0044087 GO:0044089 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0044877 GO:0046483 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0050896 GO:0051128 GO:0051130 GO:0051276 GO:0051716 GO:0051865 GO:0065003 GO:0065004 GO:0065007 GO:0070013 GO:0070646 GO:0070647 GO:0070911 GO:0070914 GO:0071214 GO:0071478 GO:0071482 GO:0071704 GO:0071824 GO:0071840 GO:0080008 GO:0090304 GO:0090305 GO:0097159 GO:0104004 GO:1901360 GO:1901363 GO:1901564 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

153

Amino Acids

16.92

Weight (kDa)

4.54

Isoelectric Point (pI)

38.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004508)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G34280
fragaria_vesca	FvH4_2g04670 FvH4_2g04670
malus_domestica	MD05G1093800.v1.1
prunus_persica	Prupe.8G138700_v2.0.a1 Prupe.8G138700_v2.0.a1
pyrus_communis	pycom05g09290
rosa_chinensis	RchiOBHm_Chr6g0254291 RchiOBHm_Chr6g0254331 RchiOBHm_Chr6g0254371
rosa_laevigata	RLG00000014132 RLG00000014922 RLG00000014929
rosa_multiflora	Rmu_sc0012713.1_g000001 Rmu_sc0012713.1_g000002 Rmu_sc0027609.1_g000001 Rmu_ssc0000412.1_g000017
rosa_roxburghii	Rroxscaffold_7G00210950
rosa_rugosa	Rorug05G0551700 Rorug05G0551800 Rorug05G0551800
rosa_samantha	Rh6AG068100 Rh6AG068600 Rh6BG061000 Rh6BG061300 Rh6CG060800 Rh6CG061200 Rh6DG057900 Rh6DG058100 Rh6DG058500
rosa_wichuraiana	Rw6G005970 Rw6G006010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	26
AcuI	CTGAAG	1 cut(s)	428
AfaI	GTAC	1 cut(s)	220
AfiI	CCNNNNNNNGG	2 cut(s)	212, 368
AgsI	TTSAA	2 cut(s)	81, 132
AluBI	AGCT	4 cut(s)	212, 243, 424, 431
AluI	AGCT	4 cut(s)	212, 243, 424, 431
AspA2I	CCTAGG	1 cut(s)	251
AsuHPI	GGTGA	2 cut(s)	242, 323
AvrII	CCTAGG	1 cut(s)	251
BbvCI	CCTCAGC	1 cut(s)	48
BccI	CCATC	3 cut(s)	280, 302, 370
BciVI	GTATCC	1 cut(s)	423
BfaI	CTAG	4 cut(s)	71, 252, 282, 368
BfuI	GTATCC	1 cut(s)	423
BlnI	CCTAGG	1 cut(s)	251
BmcAI	AGTACT	1 cut(s)	220
Bpu10I	CCTNAGC	1 cut(s)	48
BpuEI	CTTGAG	1 cut(s)	389
BsaJI	CCNNGG	1 cut(s)	251
BsaXI	ACNNNNNCTCC	2 cut(s)	101, 131
Bsc4I	CCNNNNNNNGG	2 cut(s)	212, 368
Bse3DI	GCAATG	1 cut(s)	381
BseDI	CCNNGG	1 cut(s)	251
BseGI	GGATG	2 cut(s)	268, 272
BseLI	CCNNNNNNNGG	2 cut(s)	212, 368
BseMI	GCAATG	1 cut(s)	381
BseMII	CTCAG	2 cut(s)	39, 153
BseYI	CCCAGC	1 cut(s)	388
BslFI	GGGAC	2 cut(s)	69, 405
BslI	CCNNNNNNNGG	2 cut(s)	212, 368
BsmFI	GGGAC	2 cut(s)	69, 405
Bsp143I	GATC	1 cut(s)	147
BspCNI	CTCAG	2 cut(s)	40, 154
BsrDI	GCAATG	1 cut(s)	381
BssECI	CCNNGG	1 cut(s)	251
BssMI	GATC	1 cut(s)	147
BssT1I	CCWWGG	1 cut(s)	251
Bst4CI	ACNGT	1 cut(s)	143
BstC8I	GCNNGC	1 cut(s)	214
BstDEI	CTNAG	3 cut(s)	48, 162, 420
BstF5I	GGATG	2 cut(s)	268, 272
BstKTI	GATC	1 cut(s)	150
BstMBI	GATC	1 cut(s)	147
BstXI	CCANNNNNNTGG	1 cut(s)	338
BsuI	GTATCC	1 cut(s)	423
BtsCI	GGATG	2 cut(s)	268, 272
Cac8I	GCNNGC	1 cut(s)	214
Csp6I	GTAC	1 cut(s)	219
CviAII	CATG	2 cut(s)	98, 332
CviJI	RGCY	8 cut(s)	47, 205, 212, 243, 403, 424, 431, 455
CviKI_1	RGCY	8 cut(s)	47, 205, 212, 243, 403, 424, 431, 455
CviQI	GTAC	1 cut(s)	219
DdeI	CTNAG	3 cut(s)	48, 162, 420
DpnI	GATC	1 cut(s)	149
DpnII	GATC	1 cut(s)	147
Eco130I	CCWWGG	1 cut(s)	251
Eco57I	CTGAAG	1 cut(s)	428
EcoT14I	CCWWGG	1 cut(s)	251
ErhI	CCWWGG	1 cut(s)	251
FaeI	CATG	2 cut(s)	101, 335
FaiI	YATR	5 cut(s)	26, 99, 290, 333, 357
FaqI	GGGAC	2 cut(s)	69, 405
FatI	CATG	2 cut(s)	97, 331
FokI	GGATG	2 cut(s)	255, 259
FspBI	CTAG	4 cut(s)	71, 252, 282, 368
GsaI	CCCAGC	1 cut(s)	392
Hin1II	CATG	2 cut(s)	101, 335
HincII	GTYRAC	1 cut(s)	328
HindII	GTYRAC	1 cut(s)	328
HinfI	GANTC	4 cut(s)	53, 167, 187, 393
HphI	GGTGA	2 cut(s)	242, 323
Hpy166II	GTNNAC	1 cut(s)	328
Hpy188I	TCNGA	5 cut(s)	58, 147, 186, 439, 447
Hpy188III	TCNNGA	3 cut(s)	132, 173, 406
Hpy8I	GTNNAC	1 cut(s)	328
HpyCH4III	ACNGT	1 cut(s)	143
HpyCH4V	TGCA	2 cut(s)	91, 323
HpyF3I	CTNAG	3 cut(s)	48, 162, 420
Hsp92II	CATG	2 cut(s)	101, 335
Kzo9I	GATC	1 cut(s)	147
LmnI	GCTCC	2 cut(s)	109, 371
LpnPI	CCDG	5 cut(s)	101, 198, 209, 374, 417
MaeI	CTAG	4 cut(s)	71, 252, 282, 368
MalI	GATC	1 cut(s)	149
MboI	GATC	1 cut(s)	147
MluCI	AATT	1 cut(s)	345
MlyI	GAGTC	1 cut(s)	387
MmeI	TCCRAC	1 cut(s)	300
MnlI	CCTC	5 cut(s)	43, 128, 157, 190, 427
MseI	TTAA	1 cut(s)	12
MslI	CAYNNNNRTG	1 cut(s)	336
NdeII	GATC	1 cut(s)	147
NlaIII	CATG	2 cut(s)	101, 335
PfeI	GAWTC	3 cut(s)	53, 167, 187
PleI	GAGTC	1 cut(s)	387
PpsI	GAGTC	1 cut(s)	387
PsiI	TTATAA	1 cut(s)	26
PspFI	CCCAGC	1 cut(s)	388
RsaI	GTAC	1 cut(s)	220
RsaNI	GTAC	1 cut(s)	219
RseI	CAYNNNNRTG	1 cut(s)	336
SaqAI	TTAA	1 cut(s)	12
Sau3AI	GATC	1 cut(s)	147
ScaI	AGTACT	1 cut(s)	220
SchI	GAGTC	1 cut(s)	387
SetI	ASST	5 cut(s)	214, 232, 245, 426, 433
SmiMI	CAYNNNNRTG	1 cut(s)	336
SmlI	CTYRAG	1 cut(s)	404
SmoI	CTYRAG	1 cut(s)	404
Sse9I	AATT	1 cut(s)	345
SspMI	CTAG	4 cut(s)	71, 252, 282, 368
StyI	CCWWGG	1 cut(s)	251
TaaI	ACNGT	1 cut(s)	143
TasI	AATT	1 cut(s)	345
TatI	WGTACW	1 cut(s)	218
TfiI	GAWTC	3 cut(s)	53, 167, 187
Tru1I	TTAA	1 cut(s)	12
Tru9I	TTAA	1 cut(s)	12
TspDTI	ATGAA	2 cut(s)	51, 392
XmaJI	CCTAGG	1 cut(s)	251
XspI	CTAG	4 cut(s)	71, 252, 282, 368
ZrmI	AGTACT	1 cut(s)	220

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.