Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012732.1

Orthogroup ID

OG0006242

Physical Location & Seq

Genomic Coordinates Reverse (-)

16256 .. 17692

Gene Structure 1437 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012732.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1437 bp

atgggggctattttgagtttggctggtcccaaatctaggacaaacgattatcatgaggtttctcagaatgatacctgtaagcggcaaagaatgtcatcatgtacttatgaggagagcaaaagactaattcccaaccttcctgatgagctctcaatccaaattattgctagacttcctagaatttgctatccccatatcaggctggtgtcacagaagtggaaggaaactgttacaagctccgatctatttaagttgagaaaagagcttggaaaaacagaagaatggctgtacttgttgactaaaattgaagaggataaactctcgtggcatgcttttgaccccctgtcaaggaagtggcagaggttacctcggatgccaaacgtagtttatgaagaagagtatactagaggtttgccgtggttttcgatatggaatatggttgggccaagcatcaaaattgctgatactattaggggctggcttgggagaaagaactcatttgatcaaatgccattttgtggttgtgccattggtgctcttgatggatgcctctatgttctaggtggattttgtaaaacttcaactatgaaatgtgtgtggagatttgatccaattcaaaatgcatggagccaagtgccagccatgtccacaagtagagcctatggtaagacgggcattctgaataacaagctctatgtcgttggaggggttagtcgaggccaaggtggattggctcctcttcaatctgctgaagtttttgacccctccacaggtatgtggtccgaagtaccaagcatgccattctcaaaagctcaagccttgcctactgccttcttgactgacatgctaaagcctattgccaccgggttgactccatacatgggaaggttatgtgtatcccagagtctgtattcctggcccttttttgttgatgttggaggagaaatttatgatcctgagacaaattcatggattgaaatgccaaatggcatgggtgacggttggcctgctcggcaagctggtacaaagttgagtgttgtggtagatggtgaattgtatgcttttgatccttcgagttctttggatagtggcaagattaaggtgtatgatcaacaggaagatgcttggaaagttgttatacggaaagtccccatgtgtgatttggctggttcagaatctccatatttacttgctggttttcatggaaagcttcatgttataacaaaagatattaatcatgatatcgctgttctgcgggctgatctgcggaacaatttgggttcactgtcgtcaagctcatgttctgtcgtagctggatccttattacatgaacatcccgagtcactggcagaatcagatacagttgtgtggaaagccattggcactaaggattttgggtcaagtgatttggtcagttgtcaagttattgacatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box F-box-like Kelch_1

Protein Analysis

478

Amino Acids

53.21

Weight (kDa)

6.47

Isoelectric Point (pI)

47.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006242)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G22040
fragaria_vesca	FvH4_5g38161 FvH4_5g38161 FvH4_5g38161 FvH4_5g38161 FvH4_5g38161
malus_domestica	MD08G1176400.v1.1 MD08G1212800.v1.1 MD15G1362200.v1.1
prunus_persica	Prupe.1G510200_v2.0.a1 Prupe.1G510200_v2.0.a1 Prupe.1G510200_v2.0.a1 Prupe.1G510200_v2.0.a1
pyrus_communis	pycom08g15140 pycom15g32480
rosa_chinensis	RchiOBHm_Chr7g0240161
rosa_laevigata	RLG00000000694
rosa_multiflora	Rmu_sc0005008.1_g000006 Rmu_sc0005978.1_g000008 Rmu_sc0012732.1_g000003
rosa_roxburghii	Rroxscaffold_3G00220360
rosa_rugosa	Rorug07G0333900
rosa_samantha	Rh7AG487500 Rh7BG460600 Rh7CG504100 Rh7DG472300
rosa_wichuraiana	Rw7G040840

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1220
AccB7I	CCANNNNNTGG	1 cut(s)	518
AccI	GTMKAC	1 cut(s)	401
AciI	CCGC	3 cut(s)	82, 1255, 1267
AclWI	GGATC	5 cut(s)	602, 947, 1061, 1311, 1324
AcsI	RAATTY	3 cut(s)	180, 945, 964
AcuI	CTGAAG	1 cut(s)	771
AfaI	GTAC	4 cut(s)	103, 290, 789, 1024
AfiI	CCNNNNNNNGG	7 cut(s)	36, 81, 198, 348, 518, 770, 881
AgsI	TTSAA	5 cut(s)	308, 582, 617, 743, 977
AhdI	GACNNNNNGTC	1 cut(s)	343
AjnI	CCWGG	1 cut(s)	914
AleI	CACNNNNGTG	1 cut(s)	214
AluBI	AGCT	9 cut(s)	148, 237, 265, 691, 812, 1019, 1210, 1296, 1313
AluI	AGCT	9 cut(s)	148, 237, 265, 691, 812, 1019, 1210, 1296, 1313
Alw21I	GWGCWC	2 cut(s)	150, 538
Alw26I	GTCTC	1 cut(s)	953
AlwI	GGATC	5 cut(s)	602, 947, 1061, 1311, 1324
AlwNI	CAGNNNCTG	1 cut(s)	907
Ama87I	CYCGRG	1 cut(s)	1337
AoxI	GGCC	4 cut(s)	443, 718, 917, 1004
ApoI	RAATTY	3 cut(s)	180, 945, 964
AseI	ATTAAT	1 cut(s)	1233
AspS9I	GGNCC	4 cut(s)	26, 443, 780, 918
AsuC2I	CCSGG	1 cut(s)	865
AsuHPI	GGTGA	2 cut(s)	1007, 1061
AvaI	CYCGRG	1 cut(s)	1337
AvaII	GGWCC	2 cut(s)	26, 780
BaeI	ACNNNNGTAYC	2 cut(s)	1350, 1383
BamHI	GGATCC	1 cut(s)	1316
BanII	GRGCYC	1 cut(s)	150
BauI	CACGAG	1 cut(s)	322
Bbv12I	GWGCWC	2 cut(s)	150, 538
BccI	CCATC	2 cut(s)	536, 1040
BceAI	ACGGC	1 cut(s)	400
BciT130I	CCWGG	1 cut(s)	916
BciVI	GTATCC	1 cut(s)	907
BclI	TGATCA	2 cut(s)	502, 1108
BcnI	CCSGG	1 cut(s)	865
BcoDI	GTCTC	1 cut(s)	953
BfaI	CTAG	5 cut(s)	36, 168, 177, 405, 560
BfuI	GTATCC	1 cut(s)	907
BglI	GCCNNNNNGGC	1 cut(s)	1012
BisI	GCNGC	1 cut(s)	83
BlsI	GCNGC	1 cut(s)	84
Bme1390I	CCNGG	2 cut(s)	865, 916
Bme18I	GGWCC	2 cut(s)	26, 780
BmeRI	GACNNNNNGTC	1 cut(s)	343
BmeT110I	CYCGRG	1 cut(s)	1337
BmgT120I	GGNCC	4 cut(s)	26, 443, 780, 918
BmiI	GGNNCC	4 cut(s)	28, 629, 735, 1318
BmrFI	CCNGG	2 cut(s)	865, 916
BmsI	GCATC	4 cut(s)	363, 459, 536, 1111
BplI	GAGNNNNNCTC	2 cut(s)	352, 384
BpuEI	CTTGAG	1 cut(s)	798
BpuMI	CCSGG	1 cut(s)	865
BsaBI	GATNNNNATC	1 cut(s)	1233
BsaJI	CCNNGG	3 cut(s)	368, 416, 721
Bsc4I	CCNNNNNNNGG	7 cut(s)	36, 81, 198, 348, 518, 770, 881
Bse1I	ACTGG	1 cut(s)	1350
Bse8I	GATNNNNATC	1 cut(s)	1233
BseBI	CCWGG	1 cut(s)	916
BseDI	CCNNGG	3 cut(s)	368, 416, 721
BseGI	GGATG	3 cut(s)	378, 551, 1333
BseJI	GATNNNNATC	1 cut(s)	1233
BseLI	CCNNNNNNNGG	7 cut(s)	36, 81, 198, 348, 518, 770, 881
BseMII	CTCAG	2 cut(s)	77, 948
BseNI	ACTGG	1 cut(s)	1350
BseRI	GAGGAG	3 cut(s)	125, 726, 954
BshFI	GGCC	4 cut(s)	445, 720, 919, 1006
BsiHKAI	GWGCWC	2 cut(s)	150, 538
BsiHKCI	CYCGRG	1 cut(s)	1337
BsiSI	CCGG	1 cut(s)	864
BslFI	GGGAC	2 cut(s)	12, 1133
BslI	CCNNNNNNNGG	7 cut(s)	36, 81, 198, 348, 518, 770, 881
BsmAI	GTCTC	1 cut(s)	953
BsmFI	GGGAC	2 cut(s)	12, 1133
BsmI	GAATGC	1 cut(s)	675
BsnI	GGCC	4 cut(s)	445, 720, 919, 1006
BsoBI	CYCGRG	1 cut(s)	1337
Bsp1286I	GDGCHC	2 cut(s)	150, 538
Bsp143I	GATC	8 cut(s)	241, 502, 607, 952, 1066, 1108, 1261, 1316
BspACI	CCGC	3 cut(s)	82, 1255, 1267
BspANI	GGCC	4 cut(s)	445, 720, 919, 1006
BspCNI	CTCAG	2 cut(s)	76, 949
BspHI	TCATGA	2 cut(s)	52, 1237
BspLI	GGNNCC	4 cut(s)	28, 629, 735, 1318
BspPI	GGATC	5 cut(s)	602, 947, 1061, 1311, 1324
BsrI	ACTGG	1 cut(s)	1350
BssECI	CCNNGG	3 cut(s)	368, 416, 721
BssMI	GATC	8 cut(s)	241, 502, 607, 952, 1066, 1108, 1261, 1316
BssNAI	GTATAC	1 cut(s)	402
BssSI	CACGAG	1 cut(s)	322
BssT1I	CCWWGG	1 cut(s)	721
Bst1107I	GTATAC	1 cut(s)	402
Bst2BI	CACGAG	1 cut(s)	322
Bst2UI	CCWGG	1 cut(s)	916
Bst4CI	ACNGT	4 cut(s)	229, 1001, 1287, 1363
Bst6I	CTCTTC	3 cut(s)	303, 390, 744
BstC8I	GCNNGC	7 cut(s)	330, 479, 639, 797, 1008, 1017, 1257
BstDEI	CTNAG	3 cut(s)	63, 957, 1386
BstDSI	CCRYGG	1 cut(s)	416
BstEII	GGTNACC	1 cut(s)	363
BstF5I	GGATG	3 cut(s)	378, 551, 1333
BstKTI	GATC	8 cut(s)	244, 505, 610, 955, 1069, 1111, 1264, 1319
BstMAI	GTCTC	1 cut(s)	953
BstMBI	GATC	8 cut(s)	241, 502, 607, 952, 1066, 1108, 1261, 1316
BstMWI	GCNNNNNNNGC	3 cut(s)	533, 1012, 1016
BstNI	CCWGG	1 cut(s)	916
BstNSI	RCATGY	3 cut(s)	332, 799, 847
BstPI	GGTNACC	1 cut(s)	363
BstSCI	CCNGG	2 cut(s)	863, 914
BstX2I	RGATCY	1 cut(s)	1316
BstYI	RGATCY	1 cut(s)	1316
BstZ17I	GTATAC	1 cut(s)	402
BsuI	GTATCC	1 cut(s)	907
BsuRI	GGCC	4 cut(s)	445, 720, 919, 1006
BtgI	CCRYGG	1 cut(s)	416
BtsCI	GGATG	3 cut(s)	378, 551, 1333
BtsIMutI	CAGTG	2 cut(s)	1283, 1343
Cac8I	GCNNGC	7 cut(s)	330, 479, 639, 797, 1008, 1017, 1257
CaiI	CAGNNNCTG	1 cut(s)	907
CciI	TCATGA	2 cut(s)	52, 1237
Cfr13I	GGNCC	4 cut(s)	26, 443, 780, 918
Csp6I	GTAC	4 cut(s)	102, 289, 788, 1023
CviQI	GTAC	4 cut(s)	102, 289, 788, 1023
DdeI	CTNAG	3 cut(s)	63, 957, 1386
DpnI	GATC	8 cut(s)	243, 504, 609, 954, 1068, 1110, 1263, 1318
DpnII	GATC	8 cut(s)	241, 502, 607, 952, 1066, 1108, 1261, 1316
DriI	GACNNNNNGTC	1 cut(s)	343
Eam1104I	CTCTTC	3 cut(s)	303, 390, 744
Eam1105I	GACNNNNNGTC	1 cut(s)	343
EarI	CTCTTC	3 cut(s)	303, 390, 744
Ecl136II	GAGCTC	1 cut(s)	148
Eco130I	CCWWGG	1 cut(s)	721
Eco24I	GRGCYC	1 cut(s)	150
Eco32I	GATATC	1 cut(s)	1243
Eco47I	GGWCC	2 cut(s)	26, 780
Eco53kI	GAGCTC	1 cut(s)	148
Eco57I	CTGAAG	1 cut(s)	771
Eco88I	CYCGRG	1 cut(s)	1337
Eco91I	GGTNACC	1 cut(s)	363
EcoICRI	GAGCTC	1 cut(s)	148
EcoO65I	GGTNACC	1 cut(s)	363
EcoRII	CCWGG	1 cut(s)	914
EcoRV	GATATC	1 cut(s)	1243
EcoT14I	CCWWGG	1 cut(s)	721
EcoT22I	ATGCAT	1 cut(s)	625
EcoT38I	GRGCYC	1 cut(s)	150
ErhI	CCWWGG	1 cut(s)	721
FaqI	GGGAC	2 cut(s)	12, 1133
FauI	CCCGC	1 cut(s)	1248
FbaI	TGATCA	2 cut(s)	502, 1108
FblI	GTMKAC	1 cut(s)	401
Fnu4HI	GCNGC	1 cut(s)	83
FokI	GGATG	3 cut(s)	385, 558, 1320
FriOI	GRGCYC	1 cut(s)	150
Fsp4HI	GCNGC	1 cut(s)	83
FspBI	CTAG	5 cut(s)	36, 168, 177, 405, 560
GluI	GCNGC	1 cut(s)	83
HaeIII	GGCC	4 cut(s)	445, 720, 919, 1006
HapII	CCGG	1 cut(s)	864
HincII	GTYRAC	2 cut(s)	297, 870
HindII	GTYRAC	2 cut(s)	297, 870
HindIII	AAGCTT	1 cut(s)	1208
HinfI	GANTC	5 cut(s)	871, 904, 1175, 1340, 1352
HpaII	CCGG	1 cut(s)	864
HphI	GGTGA	2 cut(s)	1007, 1061
Hpy166II	GTNNAC	5 cut(s)	297, 402, 648, 870, 1283
Hpy188I	TCNGA	7 cut(s)	66, 241, 372, 681, 784, 1174, 1357
Hpy188III	TCNNGA	7 cut(s)	53, 140, 539, 835, 956, 1238, 1337
Hpy8I	GTNNAC	5 cut(s)	297, 402, 648, 870, 1283
HpyAV	CCTTC	5 cut(s)	146, 214, 841, 879, 1080
HpyCH4III	ACNGT	4 cut(s)	229, 1001, 1287, 1363
HpyCH4IV	ACGT	1 cut(s)	381
HpyCH4V	TGCA	1 cut(s)	623
HpyF10VI	GCNNNNNNNGC	3 cut(s)	533, 1012, 1016
HpyF3I	CTNAG	3 cut(s)	63, 957, 1386
HpySE526I	ACGT	1 cut(s)	381
Ksp22I	TGATCA	2 cut(s)	502, 1108
Kzo9I	GATC	8 cut(s)	241, 502, 607, 952, 1066, 1108, 1261, 1316
LmnI	GCTCC	3 cut(s)	242, 627, 739
LweI	GCATC	4 cut(s)	363, 459, 536, 1111
MaeI	CTAG	5 cut(s)	36, 168, 177, 405, 560
MaeII	ACGT	1 cut(s)	381
MaeIII	GTNAC	5 cut(s)	207, 229, 363, 995, 1341
MalI	GATC	8 cut(s)	243, 504, 609, 954, 1068, 1110, 1263, 1318
MboI	GATC	8 cut(s)	241, 502, 607, 952, 1066, 1108, 1261, 1316
MboII	GAAGA	6 cut(s)	290, 320, 404, 407, 731, 1130
MflI	RGATCY	1 cut(s)	1316
MhlI	GDGCHC	2 cut(s)	150, 538
MlyI	GAGTC	3 cut(s)	865, 913, 1349
MmeI	TCCRAC	2 cut(s)	682, 916
Mph1103I	ATGCAT	1 cut(s)	625
MseI	TTAA	3 cut(s)	249, 1098, 1233
MslI	CAYNNNNRTG	2 cut(s)	214, 773
MspI	CCGG	1 cut(s)	864
MspR9I	CCNGG	2 cut(s)	865, 916
Mva1269I	GAATGC	1 cut(s)	675
MvaI	CCWGG	1 cut(s)	916
MwoI	GCNNNNNNNGC	3 cut(s)	533, 1012, 1016
NciI	CCSGG	1 cut(s)	865
NdeII	GATC	8 cut(s)	241, 502, 607, 952, 1066, 1108, 1261, 1316
NlaIV	GGNNCC	4 cut(s)	28, 629, 735, 1318
NmeAIII	GCCGAG	1 cut(s)	991
NmuCI	GTSAC	3 cut(s)	207, 995, 1341
NsiI	ATGCAT	1 cut(s)	625
NspI	RCATGY	3 cut(s)	332, 799, 847
OliI	CACNNNNGTG	1 cut(s)	214
PaeI	GCATGC	2 cut(s)	332, 799
PagI	TCATGA	2 cut(s)	52, 1237
PctI	GAATGC	1 cut(s)	675
PfeI	GAWTC	2 cut(s)	1175, 1352
PflMI	CCANNNNNTGG	1 cut(s)	518
PkrI	GCNGC	1 cut(s)	84
PleI	GAGTC	3 cut(s)	865, 912, 1348
PpsI	GAGTC	3 cut(s)	865, 912, 1348
PshBI	ATTAAT	1 cut(s)	1233
PsiI	TTATAA	1 cut(s)	1220
Psp124BI	GAGCTC	1 cut(s)	150
Psp6I	CCWGG	1 cut(s)	914
PspEI	GGTNACC	1 cut(s)	363
PspGI	CCWGG	1 cut(s)	914
PspN4I	GGNNCC	4 cut(s)	28, 629, 735, 1318
PspPI	GGNCC	4 cut(s)	26, 443, 780, 918
PstNI	CAGNNNCTG	1 cut(s)	907
PsuI	RGATCY	1 cut(s)	1316
RsaI	GTAC	4 cut(s)	103, 290, 789, 1024
RsaNI	GTAC	4 cut(s)	102, 289, 788, 1023
RseI	CAYNNNNRTG	2 cut(s)	214, 773
SacI	GAGCTC	1 cut(s)	150
SaqAI	TTAA	3 cut(s)	249, 1098, 1233
SatI	GCNGC	1 cut(s)	83
Sau3AI	GATC	8 cut(s)	241, 502, 607, 952, 1066, 1108, 1261, 1316
Sau96I	GGNCC	4 cut(s)	26, 443, 780, 918
SchI	GAGTC	3 cut(s)	865, 913, 1349
ScrFI	CCNGG	2 cut(s)	865, 916
SduI	GDGCHC	2 cut(s)	150, 538
SfaNI	GCATC	4 cut(s)	363, 459, 536, 1111
SinI	GGWCC	2 cut(s)	26, 780
SmiMI	CAYNNNNRTG	2 cut(s)	214, 773
SmlI	CTYRAG	1 cut(s)	813
SmoI	CTYRAG	1 cut(s)	813
SphI	GCATGC	2 cut(s)	332, 799
SsiI	CCGC	3 cut(s)	82, 1255, 1267
SspMI	CTAG	5 cut(s)	36, 168, 177, 405, 560
SstI	GAGCTC	1 cut(s)	150
StyD4I	CCNGG	2 cut(s)	863, 914
StyI	CCWWGG	1 cut(s)	721
TaaI	ACNGT	4 cut(s)	229, 1001, 1287, 1363
TaiI	ACGT	1 cut(s)	384
TaqI	TCGA	3 cut(s)	425, 715, 1073
TatI	WGTACW	2 cut(s)	101, 288
TauI	GCSGC	1 cut(s)	85
TfiI	GAWTC	2 cut(s)	1175, 1352
Tru1I	TTAA	3 cut(s)	249, 1098, 1233
Tru9I	TTAA	3 cut(s)	249, 1098, 1233
TscAI	CASTG	2 cut(s)	1290, 1350
TseFI	GTSAC	3 cut(s)	207, 995, 1341
Tsp45I	GTSAC	3 cut(s)	207, 995, 1341
TspDTI	ATGAA	6 cut(s)	405, 602, 957, 1190, 1202, 1344
TspGWI	ACGGA	1 cut(s)	1156
TspRI	CASTG	2 cut(s)	1290, 1350
Van91I	CCANNNNNTGG	1 cut(s)	518
VpaK11BI	GGWCC	2 cut(s)	26, 780
VspI	ATTAAT	1 cut(s)	1233
XapI	RAATTY	3 cut(s)	180, 945, 964
XceI	RCATGY	3 cut(s)	332, 799, 847
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1159
XmiI	GTMKAC	1 cut(s)	401
XspI	CTAG	5 cut(s)	36, 168, 177, 405, 560
Zsp2I	ATGCAT	1 cut(s)	625

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.