Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013239.1

Orthogroup ID

OG0003800

Physical Location & Seq

Genomic Coordinates Forward (+)

1811 .. 3776

Gene Structure 1966 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013239.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1254 bp

atggggggagaattcggggacaaatggggaatggggatggggatccccaatccccgctatctaagattggggatggggcggggatggtatttatccaatggggatggggacgggaatccccaacatattcggggatggggatggtattgtgatccccatccccaacccgccccattgccatccctaagagggatggagctggacgagacggtgaaggaagacagaggagtgatgttggaggactggaaagagagtattgaggcattgcaggaccaaattgggacccaatttgagagctttttcgggtttgaggagtacctggcagcaagaacgctgattgcttctaggtcttttcagattgatgatcacgaccacggagtcggaatggttcctttggctgacattgaattcgacccgactgaaaatagtggtagcgaagaaggcaatgagtctactactagtacaacttccagtcttagtcctactactggtgctagtactactgatgatgtagcttctagtgctactgaagatggtgatttggagatggttatggtcaaagatgtcaaagttggagctgaggtcttcaacacatacggcttattgggcaatgctgcacttcttcatagatatgggtttacagagcctgataatccatttgacattgtgaatatcgacttggaacttgtacttcagtggagtgcgtctttgttttctggccagcatcgtagagcgaggctatctttgtggagaagattaggatactccggatgtgccacccacaactcggaatattttgagatttcgtttaatggggaacccccaaatgagctgctgcttttgttgtacataatgttgttacaacaggatgcatatgataagattgatctggctcaagcagccacgggaaattccaatgggcatatggacggcattttatcagataaaactgaaaaattgtccgacataactgctgagttcagtgaagcggtgttgttgacaaatactatttgcaatgctctcttgtcccttgcagatatgcgggagagcttgtatggtaaaaattcaatagaagacgacattgaagcactgaagaggtgttgtagtataaaagagaaaaagttgtaccattcgttgatgcttcgtatcagtgagaggagaatcattcagaaattcagaacatttgccacttctggttcccaagttacaactggtgaacaagcctctccgagaaagaagttgaaactaaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rubis-subs-bind SET

Protein Analysis

417

Amino Acids

46.33

Weight (kDa)

4.77

Isoelectric Point (pI)

38.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003800)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G56570 AT3G56570
fragaria_vesca	FvH4_1g25860
malus_domestica	MD00G1030500.v1.1
prunus_persica	Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1 Prupe.4G288100_v2.0.a1
pyrus_communis	pycom520g01270
rosa_chinensis	RchiOBHm_Chr3g0485001
rosa_laevigata	RLG00000023178
rosa_multiflora	Rmu_sc0006040.1_g000023 Rmu_sc0008046.1_g000001 Rmu_sc0009462.1_g000004 Rmu_sc0013239.1_g000002 Rmu_sc0029923.1_g000001 Rmu_sc0034567.1_g000001
rosa_roxburghii	Rroxscaffold_6G00397270
rosa_rugosa	Rorug03G0215100
rosa_samantha	Rh3AG265400 Rh3BG300900 Rh3BG301000 Rh3CG298800 Rh3CG299300 Rh3DG294700 Rh3DG295100
rosa_wichuraiana	Rw0G006750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	377
AccI	GTMKAC	1 cut(s)	452
AccIII	TCCGGA	1 cut(s)	767
AciI	CCGC	5 cut(s)	55, 79, 168, 989, 1042
AclWI	GGATC	3 cut(s)	37, 50, 146
AcoI	YGGCCR	1 cut(s)	718
AcsI	RAATTY	5 cut(s)	11, 407, 910, 1063, 1172
AcuI	CTGAAG	3 cut(s)	549, 677, 1112
AfaI	GTAC	6 cut(s)	317, 463, 499, 690, 848, 1127
AfiI	CCNNNNNNNGG	3 cut(s)	189, 488, 787
AgsI	TTSAA	5 cut(s)	407, 589, 1068, 1085, 1243
AhlI	ACTAGT	1 cut(s)	458
AjnI	CCWGG	1 cut(s)	318
AjuI	GAANNNNNNNTTGG	2 cut(s)	662, 694
AluBI	AGCT	6 cut(s)	199, 297, 515, 578, 832, 1050
AluI	AGCT	6 cut(s)	199, 297, 515, 578, 832, 1050
Alw26I	GTCTC	1 cut(s)	200
AlwI	GGATC	3 cut(s)	37, 50, 146
AlwNI	CAGNNNCTG	1 cut(s)	647
Aor13HI	TCCGGA	1 cut(s)	767
AoxI	GGCC	1 cut(s)	718
ApeKI	GCWGC	5 cut(s)	323, 614, 832, 835, 899
ApoI	RAATTY	5 cut(s)	11, 407, 910, 1063, 1172
ArsI	GACNNNNNNTTYG	2 cut(s)	392, 424
AspS9I	GGNCC	2 cut(s)	271, 282
AsuHPI	GGTGA	3 cut(s)	223, 548, 1226
AvaII	GGWCC	2 cut(s)	271, 282
BalI	TGGCCA	1 cut(s)	720
BamHI	GGATCC	1 cut(s)	42
BbsI	GAAGAC	3 cut(s)	225, 577, 1080
BbvCI	CCTCAGC	1 cut(s)	579
BbvI	GCAGC	5 cut(s)	335, 601, 819, 822, 911
BceAI	ACGGC	2 cut(s)	613, 946
BcgI	CGANNNNNNTGC	2 cut(s)	953, 987
BciT130I	CCWGG	1 cut(s)	320
BciVI	GTATCC	1 cut(s)	755
BclI	TGATCA	1 cut(s)	364
BcoDI	GTCTC	1 cut(s)	200
BcuI	ACTAGT	1 cut(s)	458
BfaI	CTAG	4 cut(s)	345, 459, 495, 519
BfuI	GTATCC	1 cut(s)	755
BisI	GCNGC	5 cut(s)	324, 615, 833, 836, 900
BlsI	GCNGC	5 cut(s)	325, 616, 834, 837, 901
BmcAI	AGTACT	1 cut(s)	499
Bme1390I	CCNGG	1 cut(s)	320
Bme18I	GGWCC	2 cut(s)	271, 282
BmgT120I	GGNCC	2 cut(s)	271, 282
BmiI	GGNNCC	6 cut(s)	44, 283, 284, 390, 819, 1198
BmrFI	CCNGG	1 cut(s)	320
BmsI	GCATC	3 cut(s)	733, 859, 1128
BpiI	GAAGAC	3 cut(s)	225, 577, 1080
Bpu10I	CCTNAGC	1 cut(s)	579
BpuEI	CTTGAG	1 cut(s)	879
BsaBI	GATNNNNATC	2 cut(s)	41, 156
BsaJI	CCNNGG	2 cut(s)	373, 903
BsaWI	WCCGGW	1 cut(s)	767
BsaXI	ACNNNNNCTCC	4 cut(s)	567, 597, 1037, 1067
Bsc4I	CCNNNNNNNGG	3 cut(s)	189, 488, 787
Bse1I	ACTGG	4 cut(s)	248, 471, 493, 1216
Bse3DI	GCAATG	5 cut(s)	173, 263, 451, 616, 1021
Bse8I	GATNNNNATC	2 cut(s)	41, 156
BseAI	TCCGGA	1 cut(s)	767
BseBI	CCWGG	1 cut(s)	320
BseDI	CCNNGG	2 cut(s)	373, 903
BseJI	GATNNNNATC	2 cut(s)	41, 156
BseLI	CCNNNNNNNGG	3 cut(s)	189, 488, 787
BseMI	GCAATG	5 cut(s)	173, 263, 451, 616, 1021
BseMII	CTCAG	2 cut(s)	570, 966
BseNI	ACTGG	4 cut(s)	248, 471, 493, 1216
BseRI	GAGGAG	3 cut(s)	240, 326, 1171
BseXI	GCAGC	5 cut(s)	335, 601, 819, 822, 911
BsgI	GTGCAG	1 cut(s)	600
BshFI	GGCC	1 cut(s)	720
BsiSI	CCGG	1 cut(s)	768
BslFI	GGGAC	4 cut(s)	32, 122, 295, 1012
BslI	CCNNNNNNNGG	3 cut(s)	189, 488, 787
BsmAI	GTCTC	1 cut(s)	200
BsmBI	CGTCTC	1 cut(s)	200
BsmFI	GGGAC	4 cut(s)	32, 122, 295, 1012
BsnI	GGCC	1 cut(s)	720
Bsp13I	TCCGGA	1 cut(s)	767
Bsp1407I	TGTACA	1 cut(s)	846
Bsp143I	GATC	4 cut(s)	42, 151, 364, 886
BspACI	CCGC	5 cut(s)	55, 79, 168, 989, 1042
BspANI	GGCC	1 cut(s)	720
BspCNI	CTCAG	2 cut(s)	571, 967
BspEI	TCCGGA	1 cut(s)	767
BspLI	GGNNCC	6 cut(s)	44, 283, 284, 390, 819, 1198
BspPI	GGATC	3 cut(s)	37, 50, 146
BsrDI	GCAATG	5 cut(s)	173, 263, 451, 616, 1021
BsrGI	TGTACA	1 cut(s)	846
BsrI	ACTGG	4 cut(s)	248, 471, 493, 1216
BssECI	CCNNGG	2 cut(s)	373, 903
BssMI	GATC	4 cut(s)	42, 151, 364, 886
Bst2UI	CCWGG	1 cut(s)	320
Bst4CI	ACNGT	1 cut(s)	211
Bst6I	CTCTTC	1 cut(s)	1088
BstAUI	TGTACA	1 cut(s)	846
BstC8I	GCNNGC	1 cut(s)	722
BstDEI	CTNAG	5 cut(s)	62, 185, 476, 579, 975
BstDSI	CCRYGG	2 cut(s)	373, 903
BstKTI	GATC	4 cut(s)	45, 154, 367, 889
BstMAI	GTCTC	1 cut(s)	200
BstMBI	GATC	4 cut(s)	42, 151, 364, 886
BstMWI	GCNNNNNNNGC	4 cut(s)	441, 521, 606, 899
BstNI	CCWGG	1 cut(s)	320
BstSCI	CCNGG	1 cut(s)	318
BstV1I	GCAGC	5 cut(s)	335, 601, 819, 822, 911
BstV2I	GAAGAC	3 cut(s)	225, 577, 1080
BstX2I	RGATCY	1 cut(s)	42
BstYI	RGATCY	1 cut(s)	42
BsuI	GTATCC	1 cut(s)	755
BsuRI	GGCC	1 cut(s)	720
BtgI	CCRYGG	2 cut(s)	373, 903
BtsIMutI	CAGTG	4 cut(s)	701, 988, 1088, 1156
Cac8I	GCNNGC	1 cut(s)	722
CaiI	CAGNNNCTG	1 cut(s)	647
Cfr13I	GGNCC	2 cut(s)	271, 282
CseI	GACGC	1 cut(s)	693
Csp6I	GTAC	6 cut(s)	316, 462, 498, 689, 847, 1126
CviQI	GTAC	6 cut(s)	316, 462, 498, 689, 847, 1126
DdeI	CTNAG	5 cut(s)	62, 185, 476, 579, 975
DpnI	GATC	4 cut(s)	44, 153, 366, 888
DpnII	GATC	4 cut(s)	42, 151, 364, 886
DrdI	GACNNNNNNGTC	1 cut(s)	377
DseDI	GACNNNNNNGTC	1 cut(s)	377
EaeI	YGGCCR	1 cut(s)	718
Eam1104I	CTCTTC	1 cut(s)	1088
EarI	CTCTTC	1 cut(s)	1088
Eco47I	GGWCC	2 cut(s)	271, 282
Eco57I	CTGAAG	3 cut(s)	549, 677, 1112
EcoO109I	RGGNCCY	1 cut(s)	282
EcoRI	GAATTC	2 cut(s)	11, 407
EcoRII	CCWGG	1 cut(s)	318
EcoT22I	ATGCAT	1 cut(s)	874
Esp3I	CGTCTC	1 cut(s)	200
FaqI	GGGAC	4 cut(s)	32, 122, 295, 1012
FauI	CCCGC	4 cut(s)	62, 72, 175, 1035
FauNDI	CATATG	2 cut(s)	874, 924
FbaI	TGATCA	1 cut(s)	364
FblI	GTMKAC	1 cut(s)	452
Fnu4HI	GCNGC	5 cut(s)	324, 615, 833, 836, 900
Fsp4HI	GCNGC	5 cut(s)	324, 615, 833, 836, 900
FspBI	CTAG	4 cut(s)	345, 459, 495, 519
GluI	GCNGC	5 cut(s)	324, 615, 833, 836, 900
HaeIII	GGCC	1 cut(s)	720
HapII	CCGG	1 cut(s)	768
HgaI	GACGC	1 cut(s)	693
HincII	GTYRAC	1 cut(s)	999
HindII	GTYRAC	1 cut(s)	999
HinfI	GANTC	4 cut(s)	115, 378, 449, 1161
HpaII	CCGG	1 cut(s)	768
HphI	GGTGA	3 cut(s)	223, 548, 1226
Hpy166II	GTNNAC	4 cut(s)	453, 639, 999, 1217
Hpy188I	TCNGA	8 cut(s)	357, 383, 790, 943, 964, 1170, 1178, 1230
Hpy188III	TCNNGA	2 cut(s)	368, 768
Hpy8I	GTNNAC	4 cut(s)	453, 639, 999, 1217
HpyAV	CCTTC	2 cut(s)	208, 434
HpyCH4III	ACNGT	1 cut(s)	211
HpyCH4V	TGCA	5 cut(s)	268, 617, 872, 1014, 1034
HpyF10VI	GCNNNNNNNGC	4 cut(s)	441, 521, 606, 899
HpyF3I	CTNAG	5 cut(s)	62, 185, 476, 579, 975
KflI	GGGWCCC	1 cut(s)	282
Kpn2I	TCCGGA	1 cut(s)	767
Ksp22I	TGATCA	1 cut(s)	364
Kzo9I	GATC	4 cut(s)	42, 151, 364, 886
LmnI	GCTCC	2 cut(s)	196, 575
Lsp1109I	GCAGC	5 cut(s)	335, 601, 819, 822, 911
LweI	GCATC	3 cut(s)	733, 859, 1128
MaeI	CTAG	4 cut(s)	345, 459, 495, 519
MaeIII	GTNAC	2 cut(s)	858, 1204
MalI	GATC	4 cut(s)	44, 153, 366, 888
MboI	GATC	4 cut(s)	42, 151, 364, 886
MboII	GAAGA	8 cut(s)	230, 449, 542, 577, 614, 765, 1085, 1105
MflI	RGATCY	1 cut(s)	42
MlsI	TGGCCA	1 cut(s)	720
MluCI	AATT	8 cut(s)	11, 276, 287, 407, 910, 956, 1063, 1172
MluNI	TGGCCA	1 cut(s)	720
MlyI	GAGTC	2 cut(s)	387, 458
MmeI	TCCRAC	4 cut(s)	216, 361, 553, 987
Mox20I	TGGCCA	1 cut(s)	720
Mph1103I	ATGCAT	1 cut(s)	874
MroI	TCCGGA	1 cut(s)	767
MscI	TGGCCA	1 cut(s)	720
MseI	TTAA	1 cut(s)	810
MslI	CAYNNNNRTG	1 cut(s)	630
Msp20I	TGGCCA	1 cut(s)	720
MspI	CCGG	1 cut(s)	768
MspR9I	CCNGG	1 cut(s)	320
MvaI	CCWGG	1 cut(s)	320
MwoI	GCNNNNNNNGC	4 cut(s)	441, 521, 606, 899
NdeI	CATATG	2 cut(s)	874, 924
NdeII	GATC	4 cut(s)	42, 151, 364, 886
NlaIV	GGNNCC	6 cut(s)	44, 283, 284, 390, 819, 1198
NsiI	ATGCAT	1 cut(s)	874
PfeI	GAWTC	2 cut(s)	115, 1161
PkrI	GCNGC	5 cut(s)	325, 616, 834, 837, 901
PleI	GAGTC	2 cut(s)	386, 457
PpsI	GAGTC	2 cut(s)	386, 457
PpuMI	RGGWCCY	1 cut(s)	282
Psp5II	RGGWCCY	1 cut(s)	282
Psp6I	CCWGG	1 cut(s)	318
PspGI	CCWGG	1 cut(s)	318
PspN4I	GGNNCC	6 cut(s)	44, 283, 284, 390, 819, 1198
PspPI	GGNCC	2 cut(s)	271, 282
PspPPI	RGGWCCY	1 cut(s)	282
PstNI	CAGNNNCTG	1 cut(s)	647
PsuI	RGATCY	1 cut(s)	42
RsaI	GTAC	6 cut(s)	317, 463, 499, 690, 848, 1127
RsaNI	GTAC	6 cut(s)	316, 462, 498, 689, 847, 1126
RseI	CAYNNNNRTG	1 cut(s)	630
SaqAI	TTAA	1 cut(s)	810
SatI	GCNGC	5 cut(s)	324, 615, 833, 836, 900
Sau3AI	GATC	4 cut(s)	42, 151, 364, 886
Sau96I	GGNCC	2 cut(s)	271, 282
ScaI	AGTACT	1 cut(s)	499
SchI	GAGTC	2 cut(s)	387, 458
ScrFI	CCNGG	1 cut(s)	320
SfaNI	GCATC	3 cut(s)	733, 859, 1128
SinI	GGWCC	2 cut(s)	271, 282
SmiMI	CAYNNNNRTG	1 cut(s)	630
SmlI	CTYRAG	1 cut(s)	894
SmoI	CTYRAG	1 cut(s)	894
SpeI	ACTAGT	1 cut(s)	458
Sse9I	AATT	8 cut(s)	11, 276, 287, 407, 910, 956, 1063, 1172
SsiI	CCGC	5 cut(s)	55, 79, 168, 989, 1042
SspI	AATATT	1 cut(s)	794
SspMI	CTAG	4 cut(s)	345, 459, 495, 519
StyD4I	CCNGG	1 cut(s)	318
TaaI	ACNGT	1 cut(s)	211
TaqI	TCGA	2 cut(s)	411, 675
TasI	AATT	8 cut(s)	11, 276, 287, 407, 910, 956, 1063, 1172
TatI	WGTACW	4 cut(s)	461, 497, 688, 846
TfiI	GAWTC	2 cut(s)	115, 1161
Tru1I	TTAA	1 cut(s)	810
Tru9I	TTAA	1 cut(s)	810
TscAI	CASTG	4 cut(s)	701, 988, 1095, 1156
TseI	GCWGC	5 cut(s)	323, 614, 832, 835, 899
TspDTI	ATGAA	1 cut(s)	614
TspGWI	ACGGA	1 cut(s)	390
TspRI	CASTG	4 cut(s)	701, 988, 1095, 1156
VpaK11BI	GGWCC	2 cut(s)	271, 282
XapI	RAATTY	5 cut(s)	11, 407, 910, 1063, 1172
XcmI	CCANNNNNNNNNTGG	2 cut(s)	922, 1208
XmiI	GTMKAC	1 cut(s)	452
XspI	CTAG	4 cut(s)	345, 459, 495, 519
ZrmI	AGTACT	1 cut(s)	499
Zsp2I	ATGCAT	1 cut(s)	874

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.