Rmu_sc0014745.1_g000004

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014745.1
Physical Location & Seq
Reverse (-)
12118 .. 12474
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014745.1_g000004.1.cds

Sequence Viewer

Length: 357 bp
atggagtcagatcttcagcagccacatcataaaacccagcagcatatgaactccagcttgttgcggtatcgatcagcaccgagttcttatttcgcaaatgttttggacacagaattcaatgagcccttcttcaaccgagccactagccccgaaactgagcgaattttagctcgatttatgagtagtcaaggtggtgatggtggaggaacagaagaaattgtaccacatcagaaagtagtaacagatcagcaaccacaatttttggtgcctaaggtggataacgaagcagcaatgattcaacaacaacaacaacagcagcagcagcaggagcagcagcagcaacagcagcagaactga

Protein Analysis

118

Amino Acids

13.61

Weight (kDa)

5.02

Isoelectric Point (pI)

89.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 265
AciI CCGC 1 cut(s) 64
AcsI RAATTY 2 cut(s) 113, 162
AfaI GTAC 1 cut(s) 222
AgsI TTSAA 3 cut(s) 118, 133, 299
AluBI AGCT 2 cut(s) 57, 170
AluI AGCT 2 cut(s) 57, 170
ApoI RAATTY 2 cut(s) 113, 162
AsuHPI GGTGA 1 cut(s) 206
AxyI CCTNAGG 1 cut(s) 270
BanI GGYRCC 1 cut(s) 265
BanII GRGCYC 1 cut(s) 126
BarI GAAGNNNNNNTAC 2 cut(s) 204, 236
BbvI GCAGC 9 cut(s) 31, 52, 299, 328, 331, 334, 343, 346, 349
BccI CCATC 1 cut(s) 191
BfaI CTAG 1 cut(s) 144
BglII AGATCT 1 cut(s) 10
BmiI GGNNCC 1 cut(s) 267
BpmI CTGGAG 1 cut(s) 37
Bsa29I ATCGAT 1 cut(s) 70
Bse21I CCTNAGG 1 cut(s) 270
Bse3DI GCAATG 1 cut(s) 297
BseCI ATCGAT 1 cut(s) 70
BseMI GCAATG 1 cut(s) 297
BseMII CTCAG 1 cut(s) 147
BseXI GCAGC 9 cut(s) 31, 52, 299, 328, 331, 334, 343, 346, 349
BseYI CCCAGC 1 cut(s) 36
BshNI GGYRCC 1 cut(s) 265
BshVI ATCGAT 1 cut(s) 70
Bsp1286I GDGCHC 1 cut(s) 126
Bsp143I GATC 3 cut(s) 10, 71, 244
BspACI CCGC 1 cut(s) 64
BspCNI CTCAG 1 cut(s) 148
BspDI ATCGAT 1 cut(s) 70
BspLI GGNNCC 1 cut(s) 267
BspT107I GGYRCC 1 cut(s) 265
BsrDI GCAATG 1 cut(s) 297
BssMI GATC 3 cut(s) 10, 71, 244
BstDEI CTNAG 2 cut(s) 156, 270
BstKTI GATC 3 cut(s) 13, 74, 247
BstMBI GATC 3 cut(s) 10, 71, 244
BstMWI GCNNNNNNNGC 6 cut(s) 322, 328, 331, 337, 343, 346
BstV1I GCAGC 9 cut(s) 31, 52, 299, 328, 331, 334, 343, 346, 349
BstX2I RGATCY 1 cut(s) 10
BstYI RGATCY 1 cut(s) 10
Bsu15I ATCGAT 1 cut(s) 70
Bsu36I CCTNAGG 1 cut(s) 270
BsuTUI ATCGAT 1 cut(s) 70
ClaI ATCGAT 1 cut(s) 70
Csp6I GTAC 1 cut(s) 221
CspCI CAANNNNNGTGG 2 cut(s) 243, 278
CviJI RGCY 6 cut(s) 22, 57, 124, 140, 147, 170
CviKI_1 RGCY 6 cut(s) 22, 57, 124, 140, 147, 170
CviQI GTAC 1 cut(s) 221
DdeI CTNAG 2 cut(s) 156, 270
DpnI GATC 3 cut(s) 12, 73, 246
DpnII GATC 3 cut(s) 10, 71, 244
Eco24I GRGCYC 1 cut(s) 126
Eco81I CCTNAGG 1 cut(s) 270
EcoRI GAATTC 1 cut(s) 113
EcoT38I GRGCYC 1 cut(s) 126
FaiI YATR 4 cut(s) 30, 45, 47, 179
FauNDI CATATG 1 cut(s) 45
FriOI GRGCYC 1 cut(s) 126
FspBI CTAG 1 cut(s) 144
GsaI CCCAGC 1 cut(s) 40
GsuI CTGGAG 1 cut(s) 37
HinfI GANTC 2 cut(s) 5, 295
HphI GGTGA 1 cut(s) 206
Hpy188I TCNGA 2 cut(s) 10, 231
HpyAV CCTTC 1 cut(s) 136
HpyF10VI GCNNNNNNNGC 6 cut(s) 322, 328, 331, 337, 343, 346
HpyF3I CTNAG 2 cut(s) 156, 270
Kzo9I GATC 3 cut(s) 10, 71, 244
LmnI GCTCC 1 cut(s) 328
LpnPI CCDG 3 cut(s) 50, 67, 311
Lsp1109I GCAGC 9 cut(s) 31, 52, 299, 328, 331, 334, 343, 346, 349
MaeI CTAG 1 cut(s) 144
MaeIII GTNAC 1 cut(s) 238
MalI GATC 3 cut(s) 12, 73, 246
MboI GATC 3 cut(s) 10, 71, 244
MboII GAAGA 3 cut(s) 5, 121, 224
MflI RGATCY 1 cut(s) 10
MhlI GDGCHC 1 cut(s) 126
MluCI AATT 4 cut(s) 113, 162, 216, 257
MlyI GAGTC 1 cut(s) 14
MnlI CCTC 1 cut(s) 197
MwoI GCNNNNNNNGC 6 cut(s) 322, 328, 331, 337, 343, 346
NdeI CATATG 1 cut(s) 45
NdeII GATC 3 cut(s) 10, 71, 244
NlaIV GGNNCC 1 cut(s) 267
PfeI GAWTC 1 cut(s) 295
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
PspFI CCCAGC 1 cut(s) 36
PspN4I GGNNCC 1 cut(s) 267
PsuI RGATCY 1 cut(s) 10
RsaI GTAC 1 cut(s) 222
RsaNI GTAC 1 cut(s) 221
Sau3AI GATC 3 cut(s) 10, 71, 244
SchI GAGTC 1 cut(s) 14
SduI GDGCHC 1 cut(s) 126
SetI ASST 4 cut(s) 59, 172, 193, 276
Sse9I AATT 4 cut(s) 113, 162, 216, 257
SsiI CCGC 1 cut(s) 64
SspMI CTAG 1 cut(s) 144
TaqI TCGA 2 cut(s) 70, 172
TasI AATT 4 cut(s) 113, 162, 216, 257
TfiI GAWTC 1 cut(s) 295
TspDTI ATGAA 1 cut(s) 62
XapI RAATTY 2 cut(s) 113, 162
XspI CTAG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.