Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0019012.1

Orthogroup ID

OG0010576

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 834

Gene Structure 834 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0019012.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 728 bp

aagaagatgagaaggaggtgaatagtccaatgccaaagccaaagccaattgaatcagaccaaagtggtagagataatagtaataggagtcagcattgccattcagtgttgagccctatagagaatcttagtcaatggaaggaggtgaaagcgaaagcagttcctttagcttcgaatcacccagagaaggagaatatgaatgctgagcaagatttcaacataccaattagtccagagcctacactgaagctgtcaaaacacttcagaagaagaccacttgagtccaatgacctaaagcttgtagaccaagaaaatggggttgacactagcctttcgagctggttggttgaatgcgaaaccacacccaagtcgaatgctagtgacaattctgtggggaacttgatgtgtgagggagtgagttcatcaagaagtcttggagatagaccaattttaggagcatggactagtgaagagcttaagcagttatctaattcttctactctaaaacagtcgcgaagcccgagtcctgatcaaataccgatcatagggactgtagggagctactggagtcatactggtcaggccacggattcagacacaaactcttccagcagaggaatggaaaacaaagcagggaggaacagagaggatgagaaagtgaaatggaagactataccattcgaggcaaaattggagagagttttagatatgggcatacttggagcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

241

Amino Acids

26.67

Weight (kDa)

5.51

Isoelectric Point (pI)

58.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010576)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g01750
malus_domestica	MD04G1231100.v1.1 MD12G1249400.v1.1
prunus_persica	Prupe.6G350800_v2.0.a1 Prupe.6G350800_v2.0.a1
pyrus_communis	pycom04g20470 pycom12g22920
rosa_chinensis	RchiOBHm_Chr3g0449491
rosa_laevigata	RLG00000025822 RLG00000025825
rosa_multiflora	Rmu_sc0000430.1_g000018 Rmu_sc0019012.1_g000001
rosa_roxburghii	Rroxscaffold_6G00427450
rosa_rugosa	Rorug02G0621600 Rorug02G0621700
rosa_samantha	Rh3AG019800 Rh3BG019800 Rh3CG018500 Rh3DG019800
rosa_wichuraiana	Rw3G001540 Rw3G001570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	302
AccII	CGCG	1 cut(s)	513
AcuI	CTGAAG	2 cut(s)	246, 265
AfiI	CCNNNNNNNGG	3 cut(s)	186, 451, 544
AflII	CTTAAG	1 cut(s)	475
AgsI	TTSAA	3 cut(s)	52, 216, 349
AhlI	ACTAGT	1 cut(s)	463
AluBI	AGCT	7 cut(s)	169, 249, 297, 338, 474, 560, 724
AluI	AGCT	7 cut(s)	169, 249, 297, 338, 474, 560, 724
Ama87I	CYCGRG	1 cut(s)	519
AoxI	GGCC	1 cut(s)	581
ArsI	GACNNNNNNTTYG	2 cut(s)	507, 539
AsuHPI	GGTGA	3 cut(s)	30, 156, 169
AsuII	TTCGAA	1 cut(s)	172
AvaI	CYCGRG	1 cut(s)	519
BanII	GRGCYC	1 cut(s)	115
BbsI	GAAGAC	2 cut(s)	276, 673
BclI	TGATCA	1 cut(s)	528
BcuI	ACTAGT	1 cut(s)	463
BfaI	CTAG	3 cut(s)	326, 377, 464
BfmI	CTRYAG	2 cut(s)	116, 551
BfrI	CTTAAG	1 cut(s)	475
BlpI	GCTNAGC	1 cut(s)	203
BmeT110I	CYCGRG	1 cut(s)	519
BpiI	GAAGAC	2 cut(s)	276, 673
BpmI	CTGGAG	1 cut(s)	585
Bpu1102I	GCTNAGC	1 cut(s)	203
Bpu14I	TTCGAA	1 cut(s)	172
BpuEI	CTTGAG	1 cut(s)	298
BsaJI	CCNNGG	1 cut(s)	584
Bsc4I	CCNNNNNNNGG	3 cut(s)	186, 451, 544
Bse1I	ACTGG	2 cut(s)	568, 579
Bse3DI	GCAATG	1 cut(s)	93
BseDI	CCNNGG	1 cut(s)	584
BseGI	GGATG	1 cut(s)	654
BseLI	CCNNNNNNNGG	3 cut(s)	186, 451, 544
BseMI	GCAATG	1 cut(s)	93
BseMII	CTCAG	1 cut(s)	194
BseNI	ACTGG	2 cut(s)	568, 579
Bsh1236I	CGCG	1 cut(s)	513
BshFI	GGCC	1 cut(s)	583
BsiHKCI	CYCGRG	1 cut(s)	519
BslFI	GGGAC	1 cut(s)	561
BslI	CCNNNNNNNGG	3 cut(s)	186, 451, 544
BsmFI	GGGAC	1 cut(s)	561
BsmI	GAATGC	3 cut(s)	204, 355, 378
BsnI	GGCC	1 cut(s)	583
BsoBI	CYCGRG	1 cut(s)	519
Bsp119I	TTCGAA	1 cut(s)	172
Bsp1286I	GDGCHC	1 cut(s)	115
Bsp143I	GATC	2 cut(s)	528, 539
Bsp1720I	GCTNAGC	1 cut(s)	203
Bsp68I	TCGCGA	1 cut(s)	513
BspANI	GGCC	1 cut(s)	583
BspCNI	CTCAG	1 cut(s)	195
BspFNI	CGCG	1 cut(s)	513
BspQI	GCTCTTC	1 cut(s)	464
BspT104I	TTCGAA	1 cut(s)	172
BspTI	CTTAAG	1 cut(s)	475
BsrDI	GCAATG	1 cut(s)	93
BsrI	ACTGG	2 cut(s)	568, 579
BssECI	CCNNGG	1 cut(s)	584
BssMI	GATC	2 cut(s)	528, 539
Bst4CI	ACNGT	2 cut(s)	509, 552
Bst6I	CTCTTC	2 cut(s)	464, 609
BstAFI	CTTAAG	1 cut(s)	475
BstBI	TTCGAA	1 cut(s)	172
BstDEI	CTNAG	3 cut(s)	127, 203, 725
BstDSI	CCRYGG	1 cut(s)	584
BstF5I	GGATG	1 cut(s)	654
BstFNI	CGCG	1 cut(s)	513
BstKTI	GATC	2 cut(s)	531, 542
BstMBI	GATC	2 cut(s)	528, 539
BstMWI	GCNNNNNNNGC	1 cut(s)	335
BstSFI	CTRYAG	2 cut(s)	116, 551
BstUI	CGCG	1 cut(s)	513
BstV2I	GAAGAC	2 cut(s)	276, 673
BstXI	CCANNNNNNTGG	1 cut(s)	313
BsuRI	GGCC	1 cut(s)	583
BtgI	CCRYGG	1 cut(s)	584
BtsCI	GGATG	1 cut(s)	654
BtsIMutI	CAGTG	2 cut(s)	110, 241
BtuMI	TCGCGA	1 cut(s)	513
CviAII	CATG	1 cut(s)	458
DdeI	CTNAG	3 cut(s)	127, 203, 725
DpnI	GATC	2 cut(s)	530, 541
DpnII	GATC	2 cut(s)	528, 539
Eam1104I	CTCTTC	2 cut(s)	464, 609
EarI	CTCTTC	2 cut(s)	464, 609
Eco24I	GRGCYC	1 cut(s)	115
Eco57I	CTGAAG	2 cut(s)	246, 265
Eco88I	CYCGRG	1 cut(s)	519
EcoT38I	GRGCYC	1 cut(s)	115
FaeI	CATG	1 cut(s)	461
FaiI	YATR	9 cut(s)	118, 196, 220, 459, 544, 572, 673, 709, 715
FaqI	GGGAC	1 cut(s)	561
FatI	CATG	1 cut(s)	457
FbaI	TGATCA	1 cut(s)	528
FblI	GTMKAC	1 cut(s)	302
FokI	GGATG	1 cut(s)	661
FriOI	GRGCYC	1 cut(s)	115
FspBI	CTAG	3 cut(s)	326, 377, 464
GsuI	CTGGAG	1 cut(s)	585
HaeIII	GGCC	1 cut(s)	583
Hin1II	CATG	1 cut(s)	461
HincII	GTYRAC	1 cut(s)	321
HindII	GTYRAC	1 cut(s)	321
HindIII	AAGCTT	1 cut(s)	295
HinfI	GANTC	8 cut(s)	52, 87, 123, 174, 280, 522, 567, 589
HphI	GGTGA	3 cut(s)	30, 156, 169
Hpy166II	GTNNAC	2 cut(s)	303, 321
Hpy188I	TCNGA	3 cut(s)	57, 265, 594
Hpy188III	TCNNGA	4 cut(s)	232, 425, 512, 526
Hpy8I	GTNNAC	2 cut(s)	303, 321
HpyAV	CCTTC	3 cut(s)	6, 132, 180
HpyCH4III	ACNGT	2 cut(s)	509, 552
HpyF10VI	GCNNNNNNNGC	1 cut(s)	335
HpyF3I	CTNAG	3 cut(s)	127, 203, 725
Hsp92II	CATG	1 cut(s)	461
Ksp22I	TGATCA	1 cut(s)	528
Kzo9I	GATC	2 cut(s)	528, 539
LguI	GCTCTTC	1 cut(s)	464
LmnI	GCTCC	3 cut(s)	454, 557, 721
LpnPI	CCDG	9 cut(s)	194, 245, 324, 539, 549, 560, 565, 617, 621
MaeI	CTAG	3 cut(s)	326, 377, 464
MaeIII	GTNAC	1 cut(s)	379
MalI	GATC	2 cut(s)	530, 541
MboI	GATC	2 cut(s)	528, 539
MboII	GAAGA	7 cut(s)	16, 278, 281, 481, 485, 596, 678
MfeI	CAATTG	1 cut(s)	47
MhlI	GDGCHC	1 cut(s)	115
MluCI	AATT	6 cut(s)	47, 224, 384, 446, 489, 688
MlyI	GAGTC	4 cut(s)	96, 289, 531, 576
MnlI	CCTC	7 cut(s)	9, 135, 402, 607, 629, 639, 675
MseI	TTAA	1 cut(s)	476
MspCI	CTTAAG	1 cut(s)	475
MunI	CAATTG	1 cut(s)	47
Mva1269I	GAATGC	3 cut(s)	204, 355, 378
MvnI	CGCG	1 cut(s)	513
MwoI	GCNNNNNNNGC	1 cut(s)	335
NdeII	GATC	2 cut(s)	528, 539
NlaIII	CATG	1 cut(s)	461
NmuCI	GTSAC	1 cut(s)	379
NruI	TCGCGA	1 cut(s)	513
NspV	TTCGAA	1 cut(s)	172
PciSI	GCTCTTC	1 cut(s)	464
PcsI	WCGNNNNNNNCGW	1 cut(s)	517
PctI	GAATGC	3 cut(s)	204, 355, 378
PfeI	GAWTC	4 cut(s)	52, 123, 174, 589
PleI	GAGTC	4 cut(s)	95, 288, 530, 575
PpsI	GAGTC	4 cut(s)	95, 288, 530, 575
RruI	TCGCGA	1 cut(s)	513
SapI	GCTCTTC	1 cut(s)	464
SaqAI	TTAA	1 cut(s)	476
Sau3AI	GATC	2 cut(s)	528, 539
SchI	GAGTC	4 cut(s)	96, 289, 531, 576
SduI	GDGCHC	1 cut(s)	115
SfcI	CTRYAG	2 cut(s)	116, 551
SfuI	TTCGAA	1 cut(s)	172
SmlI	CTYRAG	2 cut(s)	277, 475
SmoI	CTYRAG	2 cut(s)	277, 475
SpeI	ACTAGT	1 cut(s)	463
Sse9I	AATT	6 cut(s)	47, 224, 384, 446, 489, 688
SspMI	CTAG	3 cut(s)	326, 377, 464
TaaI	ACNGT	2 cut(s)	509, 552
TaqI	TCGA	4 cut(s)	172, 334, 370, 680
TasI	AATT	6 cut(s)	47, 224, 384, 446, 489, 688
TfiI	GAWTC	4 cut(s)	52, 123, 174, 589
Tru1I	TTAA	1 cut(s)	476
Tru9I	TTAA	1 cut(s)	476
TscAI	CASTG	2 cut(s)	110, 248
TseFI	GTSAC	1 cut(s)	379
Tsp45I	GTSAC	1 cut(s)	379
TspDTI	ATGAA	2 cut(s)	211, 410
TspGWI	ACGGA	1 cut(s)	601
TspRI	CASTG	2 cut(s)	110, 248
Vha464I	CTTAAG	1 cut(s)	475
XcmI	CCANNNNNNNNNTGG	1 cut(s)	615
XmiI	GTMKAC	1 cut(s)	302
XspI	CTAG	3 cut(s)	326, 377, 464

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.