Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0019023.1

Orthogroup ID

OG0009346

Physical Location & Seq

Genomic Coordinates Forward (+)

14989 .. 15648

Gene Structure 660 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0019023.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 660 bp

ctggtattgcctccttaccagcataagggttatggacggtacattctagaggttctcaatcatgttgcagtatctgaagacatctatgacttcacagtagaagaaccattggactactttcaacatgtacgcacttgtgttgatgtactacgccttcagaaattagattctgttcgcgatgcagtcaatttggctgtttcaaatctgacacgaggaaaactgtcaaagaaaacgagcatccctcgactgatgccaaccacaagagtcattgaggatgtgaggaaaagcttgaaaatcaacaagaaacaatttcttcaatgttgggaggttttcatctatcttggcctcgatccagtggacaagtacatggaggattttgtgagcattgtttctaatcgcatgaaggaagatctcatcggaaaagaatctgggaccggtggaaagcaagtaattgaagttccaagtgaatacataccagagatgtcatttgttatgttcaagtccaatgctggtgaagctactagtactgttcaggtagatgaaaatcaaccaaatcaggaggaacaactccagcagctagttgatgagagagtgaatgagatcaaatcaatagcagagaaagtatctcagcatcgcacaagcattgtcgagtcatcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000228 GO:0000785 GO:0000790 GO:0003674 GO:0003824 GO:0004402 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005694 GO:0005737 GO:0005829 GO:0006325 GO:0006464 GO:0006473 GO:0006475 GO:0006807 GO:0006996 GO:0008080 GO:0008150 GO:0008152 GO:0009987 GO:0010485 GO:0016043 GO:0016407 GO:0016410 GO:0016569 GO:0016570 GO:0016573 GO:0016740 GO:0016746 GO:0016747 GO:0018193 GO:0018205 GO:0018393 GO:0018394 GO:0019538 GO:0031974 GO:0031981 GO:0034212 GO:0036211 GO:0042393 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043412 GO:0043543 GO:0043967 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044444 GO:0044446 GO:0044454 GO:0044464 GO:0051276 GO:0061733 GO:0070013 GO:0071704 GO:0071840 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko05034 map05034

Pfam Domains

Protein Families

Acetyltransf_1 Hat1_N

Protein Analysis

219

Amino Acids

25.08

Weight (kDa)

5.36

Isoelectric Point (pI)

41.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009346)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G56740 AT5G56740
fragaria_vesca	FvH4_1g06810
malus_domestica	MD02G1072700.v1.1 MD15G1202500.v1.1
prunus_persica	Prupe.7G214700_v2.0.a1
pyrus_communis	pycom02g05690 pycom15g17990
rosa_chinensis	RchiOBHm_Chr2g0092581
rosa_laevigata	RLG00000016325
rosa_multiflora	Rmu_sc0018576.1_g000001 Rmu_sc0019023.1_g000002
rosa_roxburghii	Rroxscaffold_2G00147670 Rroxscaffold_2G00147690 Rroxscaffold_2G00148950
rosa_rugosa	Rorug02G0027700
rosa_samantha	Rh2AG073600 Rh2AG087300 Rh2BG074500 Rh2CG075600 Rh2DG072700
rosa_wichuraiana	Rw2G005930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	177
AclWI	GGATC	1 cut(s)	344
AcuI	CTGAAG	2 cut(s)	96, 140
AfaI	GTAC	5 cut(s)	41, 129, 147, 365, 526
AfiI	CCNNNNNNNGG	1 cut(s)	25
AflIII	ACRYGT	1 cut(s)	124
AgeI	ACCGGT	1 cut(s)	434
AgsI	TTSAA	6 cut(s)	122, 201, 292, 317, 455, 499
AhlI	ACTAGT	1 cut(s)	521
AluBI	AGCT	3 cut(s)	288, 518, 577
AluI	AGCT	3 cut(s)	288, 518, 577
AlwI	GGATC	1 cut(s)	344
AlwNI	CAGNNNCTG	1 cut(s)	74
AoxI	GGCC	1 cut(s)	343
ApeKI	GCWGC	1 cut(s)	574
AsiGI	ACCGGT	1 cut(s)	434
AspS9I	GGNCC	1 cut(s)	432
AsuHPI	GGTGA	1 cut(s)	524
AvaII	GGWCC	1 cut(s)	432
BarI	GAAGNNNNNNTAC	2 cut(s)	138, 170
BauI	CACGAG	1 cut(s)	210
BbsI	GAAGAC	1 cut(s)	84
BbvI	GCAGC	1 cut(s)	586
BcuI	ACTAGT	1 cut(s)	521
BfaI	CTAG	3 cut(s)	47, 522, 578
BglII	AGATCT	1 cut(s)	409
BisI	GCNGC	1 cut(s)	575
BlsI	GCNGC	1 cut(s)	576
BmcAI	AGTACT	1 cut(s)	526
Bme18I	GGWCC	1 cut(s)	432
BmgT120I	GGNCC	1 cut(s)	432
BmiI	GGNNCC	1 cut(s)	433
BmsI	GCATC	4 cut(s)	169, 240, 246, 640
BpiI	GAAGAC	1 cut(s)	84
BplI	GAGNNNNNCTC	2 cut(s)	226, 258
BpmI	CTGGAG	1 cut(s)	554
BsaBI	GATNNNNATC	1 cut(s)	543
BsaWI	WCCGGW	1 cut(s)	434
Bsc4I	CCNNNNNNNGG	1 cut(s)	25
Bse118I	RCCGGY	1 cut(s)	434
Bse1I	ACTGG	1 cut(s)	353
Bse8I	GATNNNNATC	1 cut(s)	543
BseGI	GGATG	2 cut(s)	237, 280
BseJI	GATNNNNATC	1 cut(s)	543
BseLI	CCNNNNNNNGG	1 cut(s)	25
BseMII	CTCAG	1 cut(s)	641
BseNI	ACTGG	1 cut(s)	353
BseXI	GCAGC	1 cut(s)	586
Bsh1236I	CGCG	1 cut(s)	177
BshFI	GGCC	1 cut(s)	345
BshTI	ACCGGT	1 cut(s)	434
BsiSI	CCGG	1 cut(s)	435
BslFI	GGGAC	1 cut(s)	445
BslI	CCNNNNNNNGG	1 cut(s)	25
BsmFI	GGGAC	1 cut(s)	445
BsnI	GGCC	1 cut(s)	345
Bsp143I	GATC	3 cut(s)	349, 409, 600
Bsp68I	TCGCGA	1 cut(s)	177
BspANI	GGCC	1 cut(s)	345
BspCNI	CTCAG	1 cut(s)	640
BspFNI	CGCG	1 cut(s)	177
BspLI	GGNNCC	1 cut(s)	433
BspPI	GGATC	1 cut(s)	344
BsrFI	RCCGGY	1 cut(s)	434
BsrI	ACTGG	1 cut(s)	353
BssAI	RCCGGY	1 cut(s)	434
BssMI	GATC	3 cut(s)	349, 409, 600
BssSI	CACGAG	1 cut(s)	210
Bst2BI	CACGAG	1 cut(s)	210
Bst4CI	ACNGT	4 cut(s)	39, 97, 222, 529
BstDEI	CTNAG	1 cut(s)	627
BstF5I	GGATG	2 cut(s)	237, 280
BstFNI	CGCG	1 cut(s)	177
BstKTI	GATC	3 cut(s)	352, 412, 603
BstMBI	GATC	3 cut(s)	349, 409, 600
BstMWI	GCNNNNNNNGC	1 cut(s)	515
BstNSI	RCATGY	1 cut(s)	128
BstUI	CGCG	1 cut(s)	177
BstV1I	GCAGC	1 cut(s)	586
BstV2I	GAAGAC	1 cut(s)	84
BstX2I	RGATCY	1 cut(s)	409
BstYI	RGATCY	1 cut(s)	409
BsuRI	GGCC	1 cut(s)	345
BtgZI	GCGATG	2 cut(s)	192, 617
BtsCI	GGATG	2 cut(s)	237, 280
BtsIMutI	CAGTG	1 cut(s)	360
BtuMI	TCGCGA	1 cut(s)	177
CaiI	CAGNNNCTG	1 cut(s)	74
Cfr10I	RCCGGY	1 cut(s)	434
Cfr13I	GGNCC	1 cut(s)	432
Csp6I	GTAC	5 cut(s)	40, 128, 146, 364, 525
CspAI	ACCGGT	1 cut(s)	434
CviAII	CATG	4 cut(s)	62, 125, 367, 400
CviJI	RGCY	5 cut(s)	194, 288, 345, 518, 577
CviKI_1	RGCY	5 cut(s)	194, 288, 345, 518, 577
CviQI	GTAC	5 cut(s)	40, 128, 146, 364, 525
DdeI	CTNAG	1 cut(s)	627
DpnI	GATC	3 cut(s)	351, 411, 602
DpnII	GATC	3 cut(s)	349, 409, 600
Eco47I	GGWCC	1 cut(s)	432
Eco57I	CTGAAG	2 cut(s)	96, 140
FaeI	CATG	4 cut(s)	65, 128, 370, 403
FaiI	YATR	9 cut(s)	24, 33, 63, 87, 126, 368, 401, 473, 494
FaqI	GGGAC	1 cut(s)	445
FatI	CATG	4 cut(s)	61, 124, 366, 399
Fnu4HI	GCNGC	1 cut(s)	575
FokI	GGATG	2 cut(s)	224, 287
Fsp4HI	GCNGC	1 cut(s)	575
FspBI	CTAG	3 cut(s)	47, 522, 578
GluI	GCNGC	1 cut(s)	575
GsuI	CTGGAG	1 cut(s)	554
HaeIII	GGCC	1 cut(s)	345
HapII	CCGG	1 cut(s)	435
Hin1II	CATG	4 cut(s)	65, 128, 370, 403
HindIII	AAGCTT	1 cut(s)	286
HinfI	GANTC	4 cut(s)	167, 264, 425, 650
HpaII	CCGG	1 cut(s)	435
HphI	GGTGA	1 cut(s)	524
Hpy166II	GTNNAC	1 cut(s)	358
Hpy188I	TCNGA	4 cut(s)	76, 159, 207, 419
Hpy188III	TCNNGA	3 cut(s)	47, 176, 557
Hpy8I	GTNNAC	1 cut(s)	358
HpyAV	CCTTC	2 cut(s)	164, 397
HpyCH4III	ACNGT	4 cut(s)	39, 97, 222, 529
HpyCH4V	TGCA	2 cut(s)	68, 182
HpyF10VI	GCNNNNNNNGC	1 cut(s)	515
HpyF3I	CTNAG	1 cut(s)	627
Hsp92II	CATG	4 cut(s)	65, 128, 370, 403
Kzo9I	GATC	3 cut(s)	349, 409, 600
LpnPI	CCDG	9 cut(s)	32, 366, 414, 448, 489, 495, 518, 542, 584
Lsp1109I	GCAGC	1 cut(s)	586
LweI	GCATC	4 cut(s)	169, 240, 246, 640
MaeI	CTAG	3 cut(s)	47, 522, 578
MalI	GATC	3 cut(s)	351, 411, 602
MboI	GATC	3 cut(s)	349, 409, 600
MboII	GAAGA	4 cut(s)	89, 113, 305, 419
MflI	RGATCY	1 cut(s)	409
MluCI	AATT	4 cut(s)	161, 187, 308, 450
MlyI	GAGTC	2 cut(s)	273, 659
MseI	TTAA	1 cut(s)	658
MspI	CCGG	1 cut(s)	435
MvnI	CGCG	1 cut(s)	177
MwoI	GCNNNNNNNGC	1 cut(s)	515
NdeII	GATC	3 cut(s)	349, 409, 600
NlaIII	CATG	4 cut(s)	65, 128, 370, 403
NlaIV	GGNNCC	1 cut(s)	433
NruI	TCGCGA	1 cut(s)	177
NspI	RCATGY	1 cut(s)	128
PciI	ACATGT	1 cut(s)	124
PfeI	GAWTC	2 cut(s)	167, 425
PinAI	ACCGGT	1 cut(s)	434
PkrI	GCNGC	1 cut(s)	576
PleI	GAGTC	2 cut(s)	272, 658
PpsI	GAGTC	2 cut(s)	272, 658
PscI	ACATGT	1 cut(s)	124
PspN4I	GGNNCC	1 cut(s)	433
PspPI	GGNCC	1 cut(s)	432
PsrI	GAACNNNNNNTAC	2 cut(s)	441, 473
PstNI	CAGNNNCTG	1 cut(s)	74
PsuI	RGATCY	1 cut(s)	409
RruI	TCGCGA	1 cut(s)	177
RsaI	GTAC	5 cut(s)	41, 129, 147, 365, 526
RsaNI	GTAC	5 cut(s)	40, 128, 146, 364, 525
SaqAI	TTAA	1 cut(s)	658
SatI	GCNGC	1 cut(s)	575
Sau3AI	GATC	3 cut(s)	349, 409, 600
Sau96I	GGNCC	1 cut(s)	432
ScaI	AGTACT	1 cut(s)	526
SchI	GAGTC	2 cut(s)	273, 659
SetI	ASST	6 cut(s)	54, 290, 330, 520, 537, 579
SfaNI	GCATC	4 cut(s)	169, 240, 246, 640
SinI	GGWCC	1 cut(s)	432
SpeI	ACTAGT	1 cut(s)	521
Sse9I	AATT	4 cut(s)	161, 187, 308, 450
SspMI	CTAG	3 cut(s)	47, 522, 578
TaaI	ACNGT	4 cut(s)	39, 97, 222, 529
TaqI	TCGA	3 cut(s)	244, 348, 648
TasI	AATT	4 cut(s)	161, 187, 308, 450
TatI	WGTACW	3 cut(s)	145, 363, 524
TfiI	GAWTC	2 cut(s)	167, 425
Tru1I	TTAA	1 cut(s)	658
Tru9I	TTAA	1 cut(s)	658
TscAI	CASTG	1 cut(s)	360
TseI	GCWGC	1 cut(s)	574
TspDTI	ATGAA	3 cut(s)	322, 416, 555
TspRI	CASTG	1 cut(s)	360
VpaK11BI	GGWCC	1 cut(s)	432
XbaI	TCTAGA	1 cut(s)	46
XceI	RCATGY	1 cut(s)	128
XspI	CTAG	3 cut(s)	47, 522, 578
ZrmI	AGTACT	1 cut(s)	526

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.