Rmu_sc0020340.1_g000003

Belongs to the glyceraldehyde-3-phosphate dehydrogenase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020340.1
Physical Location & Seq
Reverse (-)
14767 .. 15899
1133 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020340.1_g000003.1.cds

Sequence Viewer

Length: 489 bp
atgacgactgtgcatgcaactacagcaacacaaaaaacagttgatggcccatcaaggaaggactggagaggtggccgaggagctgcacagaatatcattcctagttcaaccggtgctgcaaaggctgttggtaaagttctacctgaactcaatggaaagcttaccggaatggccttccgtgtcccgactcctaatgtatctgttgtggacttaacttgtcgacttgagaagagttcttcttatgaggatatcaaagctgccatcaggtatgctgctgatggaccacttagaggcattcttggatacaccgatgaagatgtggtttccaatgattttgttggtgactcaaggtccagtatctttgatgccaaggctggattagcacttagttcctcctttgttaagcttgttacgtggtatgacaatgaatggggttacaccaaccgagttttggatctcatagagcacatggcattggtggtagcttaa

Protein Analysis

162

Amino Acids

17.38

Weight (kDa)

6.73

Isoelectric Point (pI)

24.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 220
AclWI GGATC 1 cut(s) 462
AcoI YGGCCR 1 cut(s) 73
AfiI CCNNNNNNNGG 2 cut(s) 290, 451
AgeI ACCGGT 1 cut(s) 110
AgsI TTSAA 1 cut(s) 108
AhdI GACNNNNNGTC 1 cut(s) 349
AluBI AGCT 5 cut(s) 83, 160, 257, 406, 485
AluI AGCT 5 cut(s) 83, 160, 257, 406, 485
Alw21I GWGCWC 1 cut(s) 468
AlwI GGATC 1 cut(s) 462
AoxI GGCC 3 cut(s) 46, 73, 171
ApeKI GCWGC 4 cut(s) 83, 116, 257, 272
AsiGI ACCGGT 1 cut(s) 110
AspS9I GGNCC 3 cut(s) 47, 281, 351
AsuHPI GGTGA 1 cut(s) 353
AvaII GGWCC 2 cut(s) 281, 351
Bbv12I GWGCWC 1 cut(s) 468
BbvI GCAGC 4 cut(s) 70, 103, 244, 259
BccI CCATC 4 cut(s) 38, 58, 269, 272
BciVI GTATCC 1 cut(s) 296
BfaI CTAG 1 cut(s) 102
BfmI CTRYAG 1 cut(s) 21
BfuI GTATCC 1 cut(s) 296
BisI GCNGC 4 cut(s) 84, 117, 258, 273
BlsI GCNGC 4 cut(s) 85, 118, 259, 274
Bme18I GGWCC 2 cut(s) 281, 351
BmeRI GACNNNNNGTC 1 cut(s) 349
BmgT120I GGNCC 3 cut(s) 47, 281, 351
BmsI GCATC 1 cut(s) 355
BpmI CTGGAG 1 cut(s) 85
BpuEI CTTGAG 2 cut(s) 245, 331
BsaAI YACGTR 1 cut(s) 414
BsaJI CCNNGG 2 cut(s) 76, 369
BsaWI WCCGGW 2 cut(s) 110, 164
Bsc4I CCNNNNNNNGG 2 cut(s) 290, 451
Bse118I RCCGGY 1 cut(s) 110
Bse1I ACTGG 2 cut(s) 68, 354
BseDI CCNNGG 2 cut(s) 76, 369
BseLI CCNNNNNNNGG 2 cut(s) 290, 451
BseNI ACTGG 2 cut(s) 68, 354
BseRI GAGGAG 1 cut(s) 93
BseXI GCAGC 4 cut(s) 70, 103, 244, 259
BsgI GTGCAG 1 cut(s) 69
BshFI GGCC 3 cut(s) 48, 75, 173
BshTI ACCGGT 1 cut(s) 110
BsiHKAI GWGCWC 1 cut(s) 468
BsiSI CCGG 2 cut(s) 111, 165
BslFI GGGAC 1 cut(s) 167
BslI CCNNNNNNNGG 2 cut(s) 290, 451
BsmFI GGGAC 1 cut(s) 167
BsmI GAATGC 1 cut(s) 294
BsnI GGCC 3 cut(s) 48, 75, 173
Bsp1286I GDGCHC 1 cut(s) 468
Bsp143I GATC 1 cut(s) 454
BspANI GGCC 3 cut(s) 48, 75, 173
BspPI GGATC 1 cut(s) 462
BsrFI RCCGGY 1 cut(s) 110
BsrI ACTGG 2 cut(s) 68, 354
BssAI RCCGGY 1 cut(s) 110
BssECI CCNNGG 2 cut(s) 76, 369
BssMI GATC 1 cut(s) 454
BssT1I CCWWGG 1 cut(s) 369
Bst4CI ACNGT 2 cut(s) 10, 40
Bst6I CTCTTC 1 cut(s) 224
BstBAI YACGTR 1 cut(s) 414
BstC8I GCNNGC 1 cut(s) 15
BstDEI CTNAG 2 cut(s) 287, 386
BstKTI GATC 1 cut(s) 457
BstMBI GATC 1 cut(s) 454
BstMWI GCNNNNNNNGC 3 cut(s) 23, 122, 380
BstNSI RCATGY 1 cut(s) 17
BstSFI CTRYAG 1 cut(s) 21
BstV1I GCAGC 4 cut(s) 70, 103, 244, 259
BstX2I RGATCY 1 cut(s) 454
BstYI RGATCY 1 cut(s) 454
BsuI GTATCC 1 cut(s) 296
BsuRI GGCC 3 cut(s) 48, 75, 173
Cac8I GCNNGC 1 cut(s) 15
Cfr10I RCCGGY 1 cut(s) 110
Cfr13I GGNCC 3 cut(s) 47, 281, 351
CspAI ACCGGT 1 cut(s) 110
CviAII CATG 2 cut(s) 14, 469
DdeI CTNAG 2 cut(s) 287, 386
DpnI GATC 1 cut(s) 456
DpnII GATC 1 cut(s) 454
DriI GACNNNNNGTC 1 cut(s) 349
EaeI YGGCCR 1 cut(s) 73
Eam1104I CTCTTC 1 cut(s) 224
Eam1105I GACNNNNNGTC 1 cut(s) 349
EarI CTCTTC 1 cut(s) 224
Eco130I CCWWGG 1 cut(s) 369
Eco32I GATATC 1 cut(s) 250
Eco47I GGWCC 2 cut(s) 281, 351
EcoRV GATATC 1 cut(s) 250
EcoT14I CCWWGG 1 cut(s) 369
ErhI CCWWGG 1 cut(s) 369
FaeI CATG 2 cut(s) 17, 472
FaiI YATR 6 cut(s) 15, 243, 270, 420, 461, 470
FaqI GGGAC 1 cut(s) 167
FatI CATG 2 cut(s) 13, 468
FblI GTMKAC 1 cut(s) 220
Fnu4HI GCNGC 4 cut(s) 84, 117, 258, 273
Fsp4HI GCNGC 4 cut(s) 84, 117, 258, 273
FspBI CTAG 1 cut(s) 102
GluI GCNGC 4 cut(s) 84, 117, 258, 273
GsuI CTGGAG 1 cut(s) 85
HaeIII GGCC 3 cut(s) 48, 75, 173
HapII CCGG 2 cut(s) 111, 165
Hin1II CATG 2 cut(s) 17, 472
HincII GTYRAC 1 cut(s) 221
HindII GTYRAC 1 cut(s) 221
HindIII AAGCTT 2 cut(s) 158, 404
HinfI GANTC 2 cut(s) 187, 344
HpaII CCGG 2 cut(s) 111, 165
HphI GGTGA 1 cut(s) 353
Hpy166II GTNNAC 2 cut(s) 208, 221
Hpy188III TCNNGA 1 cut(s) 184
Hpy8I GTNNAC 2 cut(s) 208, 221
HpyAV CCTTC 2 cut(s) 52, 184
HpyCH4III ACNGT 2 cut(s) 10, 40
HpyCH4IV ACGT 1 cut(s) 413
HpyCH4V TGCA 4 cut(s) 13, 17, 86, 119
HpyF10VI GCNNNNNNNGC 3 cut(s) 23, 122, 380
HpyF3I CTNAG 2 cut(s) 287, 386
HpySE526I ACGT 1 cut(s) 413
Hsp92II CATG 2 cut(s) 17, 472
Kzo9I GATC 1 cut(s) 454
LmnI GCTCC 1 cut(s) 80
LpnPI CCDG 7 cut(s) 49, 124, 156, 178, 250, 360, 367
Lsp1109I GCAGC 4 cut(s) 70, 103, 244, 259
LweI GCATC 1 cut(s) 355
MaeI CTAG 1 cut(s) 102
MaeII ACGT 1 cut(s) 413
MaeIII GTNAC 3 cut(s) 341, 409, 434
MalI GATC 1 cut(s) 456
MboI GATC 1 cut(s) 454
MboII GAAGA 3 cut(s) 228, 241, 326
MflI RGATCY 1 cut(s) 454
MhlI GDGCHC 1 cut(s) 468
MlyI GAGTC 2 cut(s) 181, 338
MnlI CCTC 5 cut(s) 62, 71, 238, 284, 403
MseI TTAA 3 cut(s) 212, 402, 487
MspI CCGG 2 cut(s) 111, 165
Mva1269I GAATGC 1 cut(s) 294
MwoI GCNNNNNNNGC 3 cut(s) 23, 122, 380
NdeII GATC 1 cut(s) 454
NlaIII CATG 2 cut(s) 17, 472
NmeAIII GCCGAG 1 cut(s) 101
NmuCI GTSAC 1 cut(s) 341
NspI RCATGY 1 cut(s) 17
PaeI GCATGC 1 cut(s) 17
PctI GAATGC 1 cut(s) 294
PinAI ACCGGT 1 cut(s) 110
PkrI GCNGC 4 cut(s) 85, 118, 259, 274
PleI GAGTC 2 cut(s) 181, 338
PpsI GAGTC 2 cut(s) 181, 338
Ppu21I YACGTR 1 cut(s) 414
PspPI GGNCC 3 cut(s) 47, 281, 351
PsuI RGATCY 1 cut(s) 454
SalI GTCGAC 1 cut(s) 219
SaqAI TTAA 3 cut(s) 212, 402, 487
SatI GCNGC 4 cut(s) 84, 117, 258, 273
Sau3AI GATC 1 cut(s) 454
Sau96I GGNCC 3 cut(s) 47, 281, 351
SchI GAGTC 2 cut(s) 181, 338
SduI GDGCHC 1 cut(s) 468
SfaNI GCATC 1 cut(s) 355
SfcI CTRYAG 1 cut(s) 21
SinI GGWCC 2 cut(s) 281, 351
SmlI CTYRAG 2 cut(s) 224, 346
SmoI CTYRAG 2 cut(s) 224, 346
SphI GCATGC 1 cut(s) 17
SspMI CTAG 1 cut(s) 102
StyI CCWWGG 1 cut(s) 369
TaaI ACNGT 2 cut(s) 10, 40
TaiI ACGT 1 cut(s) 416
TaqI TCGA 1 cut(s) 220
Tru1I TTAA 3 cut(s) 212, 402, 487
Tru9I TTAA 3 cut(s) 212, 402, 487
TseFI GTSAC 1 cut(s) 341
TseI GCWGC 4 cut(s) 83, 116, 257, 272
Tsp45I GTSAC 1 cut(s) 341
TspDTI ATGAA 2 cut(s) 327, 441
TspGWI ACGGA 1 cut(s) 167
VpaK11BI GGWCC 2 cut(s) 281, 351
XceI RCATGY 1 cut(s) 17
XcmI CCANNNNNNNNNTGG 1 cut(s) 448
XmiI GTMKAC 1 cut(s) 220
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.