Rmu_sc0021834.1_g000001

Arginine methyltransferase involved in the assembly or stability of mitochondrial NADH ubiquinone oxidoreductase complex (complex I)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021834.1
Physical Location & Seq
Forward (+)
1 .. 515
515 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021834.1_g000001.1.cds

Sequence Viewer

Length: 261 bp
ttccgcggtggcccaatctcggtggctgagtatatggaggaggttttgacgaacccgaaagctgggttctacatgaaccgtgatgtttttggagccggaggtgattttatcacctccccagaagtgagccagatgttcggggagatggttggtgtttgggcgatgtctctgtgggagcagatggggcagccgggaaaaatgaacctagtagagctaggtccaggaagaggaactctcatggccgaccttcttcgggtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.4

Weight (kDa)

4.53

Isoelectric Point (pI)

47.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 6
AciI CCGC 2 cut(s) 4, 6
AcoI YGGCCR 1 cut(s) 240
AfiI CCNNNNNNNGG 4 cut(s) 19, 62, 227, 253
AjnI CCWGG 1 cut(s) 220
AluBI AGCT 2 cut(s) 62, 214
AluI AGCT 2 cut(s) 62, 214
Alw26I GTCTC 1 cut(s) 171
AoxI GGCC 2 cut(s) 10, 240
ApeKI GCWGC 1 cut(s) 187
AspS9I GGNCC 2 cut(s) 11, 218
AsuC2I CCSGG 1 cut(s) 192
AsuHPI GGTGA 2 cut(s) 103, 113
AvaII GGWCC 1 cut(s) 218
BbvI GCAGC 1 cut(s) 199
BccI CCATC 2 cut(s) 139, 175
BciT130I CCWGG 1 cut(s) 222
BcnI CCSGG 1 cut(s) 192
BcoDI GTCTC 1 cut(s) 171
BfaI CTAG 2 cut(s) 206, 215
BisI GCNGC 1 cut(s) 188
BlsI GCNGC 1 cut(s) 189
Bme1390I CCNGG 2 cut(s) 192, 222
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 2 cut(s) 11, 218
BmiI GGNNCC 1 cut(s) 94
BmrFI CCNGG 2 cut(s) 192, 222
BplI GAGNNNNNCTC 2 cut(s) 219, 251
BpuMI CCSGG 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 4
Bsc4I CCNNNNNNNGG 4 cut(s) 19, 62, 227, 253
BseBI CCWGG 1 cut(s) 222
BseDI CCNNGG 1 cut(s) 4
BseLI CCNNNNNNNGG 4 cut(s) 19, 62, 227, 253
BseMII CTCAG 1 cut(s) 18
BseRI GAGGAG 1 cut(s) 53
BseXI GCAGC 1 cut(s) 199
BseYI CCCAGC 1 cut(s) 62
Bsh1236I CGCG 1 cut(s) 6
BshFI GGCC 2 cut(s) 12, 242
BsiSI CCGG 2 cut(s) 96, 191
BslI CCNNNNNNNGG 4 cut(s) 19, 62, 227, 253
BsmAI GTCTC 1 cut(s) 171
BsnI GGCC 2 cut(s) 12, 242
BspACI CCGC 2 cut(s) 4, 6
BspANI GGCC 2 cut(s) 12, 242
BspCNI CTCAG 1 cut(s) 19
BspFNI CGCG 1 cut(s) 6
BspLI GGNNCC 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 4
Bst2UI CCWGG 1 cut(s) 222
Bst4CI ACNGT 1 cut(s) 80
Bst6I CTCTTC 1 cut(s) 220
BstDEI CTNAG 1 cut(s) 27
BstDSI CCRYGG 1 cut(s) 4
BstFNI CGCG 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 171
BstMWI GCNNNNNNNGC 1 cut(s) 184
BstNI CCWGG 1 cut(s) 222
BstSCI CCNGG 2 cut(s) 190, 220
BstUI CGCG 1 cut(s) 6
BstV1I GCAGC 1 cut(s) 199
BsuRI GGCC 2 cut(s) 12, 242
BtgI CCRYGG 1 cut(s) 4
BtgZI GCGATG 1 cut(s) 176
Cfr13I GGNCC 2 cut(s) 11, 218
Cfr42I CCGCGG 1 cut(s) 7
CspCI CAANNNNNGTGG 1 cut(s) 38
CviAII CATG 2 cut(s) 73, 238
CviJI RGCY 8 cut(s) 12, 26, 62, 95, 129, 190, 214, 242
CviKI_1 RGCY 8 cut(s) 12, 26, 62, 95, 129, 190, 214, 242
DdeI CTNAG 1 cut(s) 27
EaeI YGGCCR 1 cut(s) 240
Eam1104I CTCTTC 1 cut(s) 220
EarI CTCTTC 1 cut(s) 220
Eco47I GGWCC 1 cut(s) 218
EcoRII CCWGG 1 cut(s) 220
FaeI CATG 2 cut(s) 76, 241
FaiI YATR 5 cut(s) 33, 35, 74, 239, 259
FatI CATG 2 cut(s) 72, 237
Fnu4HI GCNGC 1 cut(s) 188
Fsp4HI GCNGC 1 cut(s) 188
FspBI CTAG 2 cut(s) 206, 215
GluI GCNGC 1 cut(s) 188
GsaI CCCAGC 1 cut(s) 66
HaeIII GGCC 2 cut(s) 12, 242
HapII CCGG 2 cut(s) 96, 191
Hin1II CATG 2 cut(s) 76, 241
HpaII CCGG 2 cut(s) 96, 191
HphI GGTGA 2 cut(s) 103, 113
HpyAV CCTTC 1 cut(s) 257
HpyCH4III ACNGT 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 184
HpyF3I CTNAG 1 cut(s) 27
Hsp92II CATG 2 cut(s) 76, 241
KspI CCGCGG 1 cut(s) 7
LmnI GCTCC 2 cut(s) 92, 175
LpnPI CCDG 7 cut(s) 48, 109, 132, 143, 204, 207, 234
Lsp1109I GCAGC 1 cut(s) 199
MaeI CTAG 2 cut(s) 206, 215
MboII GAAGA 2 cut(s) 237, 242
MnlI CCTC 5 cut(s) 31, 34, 92, 124, 221
MspA1I CMGCKG 1 cut(s) 6
MspI CCGG 2 cut(s) 96, 191
MspR9I CCNGG 2 cut(s) 192, 222
MvaI CCWGG 1 cut(s) 222
MvnI CGCG 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 184
NciI CCSGG 1 cut(s) 192
NlaIII CATG 2 cut(s) 76, 241
NlaIV GGNNCC 1 cut(s) 94
PfoI TCCNGGA 1 cut(s) 220
PkrI GCNGC 1 cut(s) 189
Psp6I CCWGG 1 cut(s) 220
PspFI CCCAGC 1 cut(s) 62
PspGI CCWGG 1 cut(s) 220
PspN4I GGNNCC 1 cut(s) 94
PspPI GGNCC 2 cut(s) 11, 218
SacII CCGCGG 1 cut(s) 7
SatI GCNGC 1 cut(s) 188
Sau96I GGNCC 2 cut(s) 11, 218
ScrFI CCNGG 2 cut(s) 192, 222
SetI ASST 8 cut(s) 45, 64, 103, 116, 207, 216, 220, 249
Sfr303I CCGCGG 1 cut(s) 7
SgrBI CCGCGG 1 cut(s) 7
SinI GGWCC 1 cut(s) 218
SsiI CCGC 2 cut(s) 4, 6
SspMI CTAG 2 cut(s) 206, 215
StyD4I CCNGG 2 cut(s) 190, 220
TaaI ACNGT 1 cut(s) 80
TseI GCWGC 1 cut(s) 187
TspDTI ATGAA 2 cut(s) 89, 215
VpaK11BI GGWCC 1 cut(s) 218
XspI CTAG 2 cut(s) 206, 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.