Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0023624.1

Orthogroup ID

OG0008559

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 679

Gene Structure 679 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0023624.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 619 bp

atggacttgcagcaaaaagatgaccctcctaaaccttcagtgaaagcagcgactgtgtatcagcattttctgctgaatttcatcgtggaaaattacttgggtcctgatatcaagtttgataagctgagatactcggcatttcacagattagctgaaggttcacctccgtatgagttgagtgatttgggtgcttcatatgttagcgtgtctcttttggagagtttgtattactatatcctgagaaatgctcaccctagcttggttctcagaccaaatatgttgcataagtatttaaagggcagcctacctttgtcaagttcaggggtgagaaaagacagtcggcagttcccagatattttccctttgaatcttcatcaacagatatggtatccagaaagcttcagaattgttaaggggattgtaattattgatgaccctgttacctcatatatgaaagaagatgatctggaaaagttcaaatctttatctggtatgaataacctgaaaattgatgtggatgaatccagcaaatatcgacaggagtaccagaatggtgggaaaagtgagcacaatttctgcatggacagtgatgaggcaggatatatttccaatggaaatg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0008150 GO:0009893 GO:0010604 GO:0019219 GO:0019222 GO:0031323 GO:0031325 GO:0045935 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0051052 GO:0051054 GO:0051171 GO:0051173 GO:0060255 GO:0065007 GO:0080090 GO:1901535 GO:1901537

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

206

Amino Acids

23.64

Weight (kDa)

5.86

Isoelectric Point (pI)

34.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008559)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G20870 AT1G20870
fragaria_vesca	FvH4_5g26010
malus_domestica	MD06G1004600.v1.1
prunus_persica	Prupe.5G005900_v2.0.a1 Prupe.5G005900_v2.0.a1 Prupe.5G005900_v2.0.a1
pyrus_communis	pycom06g00420
rosa_chinensis	RchiOBHm_Chr7g0216621
rosa_laevigata	RLG00000002553 RLG00000002557 RLG00000002558
rosa_multiflora	Rmu_co8318477.1_g000001 Rmu_sc0023624.1_g000001
rosa_roxburghii	Rroxscaffold_3G00243060
rosa_rugosa	Rorug07G0161000 Rorug07G0161000 Rorug07G0161100
rosa_samantha	Rh7AG301100 Rh7BG292600 Rh7CG319700 Rh7DG301700
rosa_wichuraiana	Rw7G025550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	76
AcuI	CTGAAG	3 cut(s)	21, 174, 385
AfaI	GTAC	1 cut(s)	545
AfiI	CCNNNNNNNGG	1 cut(s)	259
AgsI	TTSAA	2 cut(s)	367, 478
AluBI	AGCT	4 cut(s)	124, 152, 258, 399
AluI	AGCT	4 cut(s)	124, 152, 258, 399
Alw21I	GWGCWC	1 cut(s)	570
Alw26I	GTCTC	1 cut(s)	213
AlwNI	CAGNNNCTG	1 cut(s)	53
ApeKI	GCWGC	3 cut(s)	10, 47, 300
ApoI	RAATTY	1 cut(s)	76
AspS9I	GGNCC	1 cut(s)	101
AsuHPI	GGTGA	3 cut(s)	153, 242, 337
AvaII	GGWCC	1 cut(s)	101
BaeI	ACNNNNGTAYC	2 cut(s)	527, 560
Bbv12I	GWGCWC	1 cut(s)	570
BbvI	GCAGC	3 cut(s)	22, 59, 312
BciVI	GTATCC	1 cut(s)	399
BcoDI	GTCTC	1 cut(s)	213
BfaI	CTAG	1 cut(s)	255
BfuI	GTATCC	1 cut(s)	399
BisI	GCNGC	3 cut(s)	11, 48, 301
BlsI	GCNGC	3 cut(s)	12, 49, 302
Bme18I	GGWCC	1 cut(s)	101
BmgT120I	GGNCC	1 cut(s)	101
BmiI	GGNNCC	1 cut(s)	102
BplI	GAGNNNNNCTC	2 cut(s)	232, 264
BsaXI	ACNNNNNCTCC	2 cut(s)	209, 239
Bsc4I	CCNNNNNNNGG	1 cut(s)	259
BseGI	GGATG	1 cut(s)	523
BseLI	CCNNNNNNNGG	1 cut(s)	259
BseMII	CTCAG	3 cut(s)	116, 230, 280
BseXI	GCAGC	3 cut(s)	22, 59, 312
BsiHKAI	GWGCWC	1 cut(s)	570
BslI	CCNNNNNNNGG	1 cut(s)	259
BsmAI	GTCTC	1 cut(s)	213
Bsp1286I	GDGCHC	1 cut(s)	570
Bsp143I	GATC	1 cut(s)	463
BspCNI	CTCAG	3 cut(s)	117, 231, 279
BspLI	GGNNCC	1 cut(s)	102
BssMI	GATC	1 cut(s)	463
Bst4CI	ACNGT	3 cut(s)	55, 338, 587
BstAPI	GCANNNNNTGC	1 cut(s)	70
BstDEI	CTNAG	3 cut(s)	125, 239, 266
BstF5I	GGATG	1 cut(s)	523
BstKTI	GATC	1 cut(s)	466
BstMAI	GTCTC	1 cut(s)	213
BstMBI	GATC	1 cut(s)	463
BstMWI	GCNNNNNNNGC	1 cut(s)	70
BstV1I	GCAGC	3 cut(s)	22, 59, 312
BstXI	CCANNNNNNTGG	1 cut(s)	554
BsuI	GTATCC	1 cut(s)	399
BtsCI	GGATG	1 cut(s)	523
BtsIMutI	CAGTG	2 cut(s)	45, 592
CaiI	CAGNNNCTG	1 cut(s)	53
Cfr13I	GGNCC	1 cut(s)	101
Csp6I	GTAC	1 cut(s)	544
CviAII	CATG	1 cut(s)	580
CviJI	RGCY	5 cut(s)	124, 152, 258, 303, 399
CviKI_1	RGCY	5 cut(s)	124, 152, 258, 303, 399
CviQI	GTAC	1 cut(s)	544
DdeI	CTNAG	3 cut(s)	125, 239, 266
DpnI	GATC	1 cut(s)	465
DpnII	GATC	1 cut(s)	463
DraI	TTTAAA	1 cut(s)	294
Eco32I	GATATC	1 cut(s)	109
Eco47I	GGWCC	1 cut(s)	101
Eco57I	CTGAAG	3 cut(s)	21, 174, 385
EcoO109I	RGGNCCY	1 cut(s)	101
EcoRV	GATATC	1 cut(s)	109
FaeI	CATG	1 cut(s)	583
FatI	CATG	1 cut(s)	579
FauNDI	CATATG	1 cut(s)	196
Fnu4HI	GCNGC	3 cut(s)	11, 48, 301
FokI	GGATG	1 cut(s)	530
Fsp4HI	GCNGC	3 cut(s)	11, 48, 301
FspBI	CTAG	1 cut(s)	255
GluI	GCNGC	3 cut(s)	11, 48, 301
Hin1II	CATG	1 cut(s)	583
HindIII	AAGCTT	1 cut(s)	397
HinfI	GANTC	2 cut(s)	367, 521
HphI	GGTGA	3 cut(s)	153, 242, 337
Hpy166II	GTNNAC	1 cut(s)	161
Hpy188I	TCNGA	2 cut(s)	269, 404
Hpy188III	TCNNGA	4 cut(s)	104, 238, 392, 467
Hpy8I	GTNNAC	1 cut(s)	161
HpyAV	CCTTC	2 cut(s)	45, 149
HpyCH4III	ACNGT	3 cut(s)	55, 338, 587
HpyCH4V	TGCA	3 cut(s)	10, 283, 579
HpyF10VI	GCNNNNNNNGC	1 cut(s)	70
HpyF3I	CTNAG	3 cut(s)	125, 239, 266
Hsp92II	CATG	1 cut(s)	583
Kzo9I	GATC	1 cut(s)	463
Lsp1109I	GCAGC	3 cut(s)	22, 59, 312
MaeI	CTAG	1 cut(s)	255
MaeIII	GTNAC	1 cut(s)	439
MalI	GATC	1 cut(s)	465
MboI	GATC	1 cut(s)	463
MboII	GAAGA	2 cut(s)	362, 470
MhlI	GDGCHC	1 cut(s)	570
MluCI	AATT	6 cut(s)	76, 91, 405, 423, 507, 571
MnlI	CCTC	4 cut(s)	36, 174, 454, 586
MseI	TTAA	2 cut(s)	293, 411
MwoI	GCNNNNNNNGC	1 cut(s)	70
NdeI	CATATG	1 cut(s)	196
NdeII	GATC	1 cut(s)	463
NlaIII	CATG	1 cut(s)	583
NlaIV	GGNNCC	1 cut(s)	102
NmeAIII	GCCGAG	1 cut(s)	113
PfeI	GAWTC	2 cut(s)	367, 521
PkrI	GCNGC	3 cut(s)	12, 49, 302
PpuMI	RGGWCCY	1 cut(s)	101
Psp5II	RGGWCCY	1 cut(s)	101
PspN4I	GGNNCC	1 cut(s)	102
PspPI	GGNCC	1 cut(s)	101
PspPPI	RGGWCCY	1 cut(s)	101
PstNI	CAGNNNCTG	1 cut(s)	53
RsaI	GTAC	1 cut(s)	545
RsaNI	GTAC	1 cut(s)	544
SaqAI	TTAA	2 cut(s)	293, 411
SatI	GCNGC	3 cut(s)	11, 48, 301
Sau3AI	GATC	1 cut(s)	463
Sau96I	GGNCC	1 cut(s)	101
SduI	GDGCHC	1 cut(s)	570
SinI	GGWCC	1 cut(s)	101
Sse9I	AATT	6 cut(s)	76, 91, 405, 423, 507, 571
SspMI	CTAG	1 cut(s)	255
TaaI	ACNGT	3 cut(s)	55, 338, 587
TaqI	TCGA	1 cut(s)	535
TasI	AATT	6 cut(s)	76, 91, 405, 423, 507, 571
TfiI	GAWTC	2 cut(s)	367, 521
Tru1I	TTAA	2 cut(s)	293, 411
Tru9I	TTAA	2 cut(s)	293, 411
TscAI	CASTG	2 cut(s)	45, 592
TseI	GCWGC	3 cut(s)	10, 47, 300
TspDTI	ATGAA	6 cut(s)	70, 183, 362, 467, 509, 534
TspGWI	ACGGA	1 cut(s)	156
TspRI	CASTG	2 cut(s)	45, 592
VpaK11BI	GGWCC	1 cut(s)	101
XapI	RAATTY	1 cut(s)	76
XspI	CTAG	1 cut(s)	255

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.