Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0027721.1

Orthogroup ID

OG0004007

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1318

Gene Structure 1318 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0027721.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 457 bp

cttacacggtgatcttttgtattatctacagccttaccaaccaggctacactgcacctcctcgtccacatcctgatgaaactactattgaaataggaggctggacactttctgggtctcctttgagtttggacgatccacgcatcttgtcaattacggaagcagaacgtcagtttctggatactgaatatgatgagtatgctgcttcaagtagtaatggggctccatttttccgatccgctgccttaattctaatggcccttcttatcttgcgacatgcattgagggtcacagatgatgattccggtgatgatacatctgctattttctcactctttttgcttcgagcggctggatttcttttgccctgctacattatggcttgggccatcagtatcttgcagcgtcgacagcaaagacaggttagtatttcagtttattctagttttagatgttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000323 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005764 GO:0005768 GO:0005773 GO:0012505 GO:0031410 GO:0031982 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0097708

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3675 RINGv

Protein Analysis

151

Amino Acids

16.92

Weight (kDa)

4.86

Isoelectric Point (pI)

56.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004007)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G02960 AT2G02960 AT2G02960 AT2G02960 AT2G02960 AT2G02960
fragaria_vesca	FvH4_4g31340 FvH4_4g31340 FvH4_4g31340 FvH4_4g31340 FvH4_4g31340 FvH4_4g31340 FvH4_4g31340 FvH4_4g31340 FvH4_4g31340 FvH4_4g31340
malus_domestica	MD13G1072100.v1.1 MD16G1072700.v1.1
prunus_persica	Prupe.1G274900_v2.0.a1 Prupe.1G274900_v2.0.a1
pyrus_communis	pycom13g06470 pycom16g06300
rosa_chinensis	RchiOBHm_Chr4g0439841
rosa_laevigata	RLG00000006235
rosa_multiflora	Rmu_sc0027721.1_g000001
rosa_roxburghii	Rroxscaffold_5G00380740
rosa_rugosa	Rorug04G0321800 Rorug04G0321800
rosa_samantha	Rh4AG372600 Rh4BG385000 Rh4CG399400 Rh4DG379300
rosa_wichuraiana	Rw4G031850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	348
AccI	GTMKAC	1 cut(s)	407
AciI	CCGC	2 cut(s)	238, 348
AclWI	GGATC	2 cut(s)	129, 229
AgsI	TTSAA	2 cut(s)	90, 208
AjnI	CCWGG	1 cut(s)	41
Alw26I	GTCTC	1 cut(s)	121
AlwI	GGATC	2 cut(s)	129, 229
AlwNI	CAGNNNCTG	1 cut(s)	176
AoxI	GGCC	2 cut(s)	256, 385
ApeKI	GCWGC	3 cut(s)	201, 240, 401
AspS9I	GGNCC	2 cut(s)	257, 385
AsuHPI	GGTGA	2 cut(s)	21, 318
BanII	GRGCYC	1 cut(s)	224
BbvI	GCAGC	3 cut(s)	188, 227, 413
BccI	CCATC	1 cut(s)	396
BciT130I	CCWGG	1 cut(s)	43
BciVI	GTATCC	1 cut(s)	173
BcoDI	GTCTC	1 cut(s)	121
BfaI	CTAG	1 cut(s)	442
BfmI	CTRYAG	1 cut(s)	27
BfuI	GTATCC	1 cut(s)	173
BisI	GCNGC	4 cut(s)	202, 241, 349, 402
BlsI	GCNGC	4 cut(s)	203, 242, 350, 403
Bme1390I	CCNGG	1 cut(s)	43
BmgT120I	GGNCC	2 cut(s)	257, 385
BmiI	GGNNCC	1 cut(s)	223
BmrFI	CCNGG	1 cut(s)	43
BmsI	GCATC	1 cut(s)	151
BsaI	GGTCTC	1 cut(s)	121
BsaWI	WCCGGW	1 cut(s)	303
BsaXI	ACNNNNNCTCC	2 cut(s)	41, 71
BseBI	CCWGG	1 cut(s)	43
BseGI	GGATG	1 cut(s)	68
BseRI	GAGGAG	1 cut(s)	49
BseXI	GCAGC	3 cut(s)	188, 227, 413
BsgI	GTGCAG	1 cut(s)	37
BshFI	GGCC	2 cut(s)	258, 387
BsiSI	CCGG	1 cut(s)	304
BsmAI	GTCTC	1 cut(s)	121
BsnI	GGCC	2 cut(s)	258, 387
Bso31I	GGTCTC	1 cut(s)	121
Bsp1286I	GDGCHC	1 cut(s)	224
Bsp143I	GATC	3 cut(s)	11, 134, 234
BspACI	CCGC	2 cut(s)	238, 348
BspANI	GGCC	2 cut(s)	258, 387
BspLI	GGNNCC	1 cut(s)	223
BspPI	GGATC	2 cut(s)	129, 229
BspTNI	GGTCTC	1 cut(s)	121
BsrBI	CCGCTC	1 cut(s)	348
BssMI	GATC	3 cut(s)	11, 134, 234
Bst2UI	CCWGG	1 cut(s)	43
Bst4CI	ACNGT	1 cut(s)	9
BstF5I	GGATG	1 cut(s)	68
BstKTI	GATC	3 cut(s)	14, 137, 237
BstMAI	GTCTC	1 cut(s)	121
BstMBI	GATC	3 cut(s)	11, 134, 234
BstMWI	GCNNNNNNNGC	1 cut(s)	410
BstNI	CCWGG	1 cut(s)	43
BstNSI	RCATGY	1 cut(s)	279
BstSCI	CCNGG	1 cut(s)	41
BstSFI	CTRYAG	1 cut(s)	27
BstV1I	GCAGC	3 cut(s)	188, 227, 413
BsuI	GTATCC	1 cut(s)	173
BsuRI	GGCC	2 cut(s)	258, 387
BtsCI	GGATG	1 cut(s)	68
BtsI	GCAGTG	1 cut(s)	49
BtsIMutI	CAGTG	1 cut(s)	49
CaiI	CAGNNNCTG	1 cut(s)	176
Cfr13I	GGNCC	2 cut(s)	257, 385
CseI	GACGC	1 cut(s)	393
CspCI	CAANNNNNGTGG	2 cut(s)	127, 162
CviAII	CATG	1 cut(s)	276
CviJI	RGCY	8 cut(s)	32, 46, 100, 222, 258, 351, 381, 387
CviKI_1	RGCY	8 cut(s)	32, 46, 100, 222, 258, 351, 381, 387
DpnI	GATC	3 cut(s)	13, 136, 236
DpnII	GATC	3 cut(s)	11, 134, 234
Eco24I	GRGCYC	1 cut(s)	224
Eco31I	GGTCTC	1 cut(s)	121
EcoRII	CCWGG	1 cut(s)	41
EcoT22I	ATGCAT	1 cut(s)	281
EcoT38I	GRGCYC	1 cut(s)	224
FaeI	CATG	1 cut(s)	279
FaiI	YATR	4 cut(s)	190, 199, 277, 378
FatI	CATG	1 cut(s)	275
FblI	GTMKAC	1 cut(s)	407
Fnu4HI	GCNGC	4 cut(s)	202, 241, 349, 402
FokI	GGATG	1 cut(s)	55
FriOI	GRGCYC	1 cut(s)	224
Fsp4HI	GCNGC	4 cut(s)	202, 241, 349, 402
FspBI	CTAG	1 cut(s)	442
GluI	GCNGC	4 cut(s)	202, 241, 349, 402
HaeIII	GGCC	2 cut(s)	258, 387
HapII	CCGG	1 cut(s)	304
HgaI	GACGC	1 cut(s)	393
Hin1II	CATG	1 cut(s)	279
HincII	GTYRAC	1 cut(s)	408
HindII	GTYRAC	1 cut(s)	408
HinfI	GANTC	1 cut(s)	300
HpaII	CCGG	1 cut(s)	304
HphI	GGTGA	2 cut(s)	21, 318
Hpy166II	GTNNAC	2 cut(s)	66, 408
Hpy188I	TCNGA	1 cut(s)	234
Hpy188III	TCNNGA	2 cut(s)	72, 177
Hpy8I	GTNNAC	2 cut(s)	66, 408
Hpy99I	CGWCG	1 cut(s)	409
HpyAV	CCTTC	1 cut(s)	270
HpyCH4III	ACNGT	1 cut(s)	9
HpyCH4IV	ACGT	1 cut(s)	167
HpyCH4V	TGCA	3 cut(s)	54, 279, 401
HpyF10VI	GCNNNNNNNGC	1 cut(s)	410
HpySE526I	ACGT	1 cut(s)	167
Hsp92II	CATG	1 cut(s)	279
Kzo9I	GATC	3 cut(s)	11, 134, 234
LmnI	GCTCC	1 cut(s)	227
Lsp1109I	GCAGC	3 cut(s)	188, 227, 413
LweI	GCATC	1 cut(s)	151
MaeI	CTAG	1 cut(s)	442
MaeII	ACGT	1 cut(s)	167
MaeIII	GTNAC	1 cut(s)	287
MalI	GATC	3 cut(s)	13, 136, 236
MbiI	CCGCTC	1 cut(s)	348
MboI	GATC	3 cut(s)	11, 134, 234
MhlI	GDGCHC	1 cut(s)	224
MluCI	AATT	2 cut(s)	151, 247
MnlI	CCTC	4 cut(s)	67, 70, 90, 277
Mph1103I	ATGCAT	1 cut(s)	281
MseI	TTAA	2 cut(s)	246, 455
MslI	CAYNNNNRTG	1 cut(s)	73
MspA1I	CMGCKG	1 cut(s)	240
MspI	CCGG	1 cut(s)	304
MspR9I	CCNGG	1 cut(s)	43
MvaI	CCWGG	1 cut(s)	43
MwoI	GCNNNNNNNGC	1 cut(s)	410
NdeII	GATC	3 cut(s)	11, 134, 234
NlaIII	CATG	1 cut(s)	279
NlaIV	GGNNCC	1 cut(s)	223
NmuCI	GTSAC	1 cut(s)	287
NsiI	ATGCAT	1 cut(s)	281
NspI	RCATGY	1 cut(s)	279
PfeI	GAWTC	1 cut(s)	300
PkrI	GCNGC	4 cut(s)	203, 242, 350, 403
Psp6I	CCWGG	1 cut(s)	41
PspGI	CCWGG	1 cut(s)	41
PspN4I	GGNNCC	1 cut(s)	223
PspPI	GGNCC	2 cut(s)	257, 385
PstNI	CAGNNNCTG	1 cut(s)	176
RseI	CAYNNNNRTG	1 cut(s)	73
SalI	GTCGAC	1 cut(s)	406
SaqAI	TTAA	2 cut(s)	246, 455
SatI	GCNGC	4 cut(s)	202, 241, 349, 402
Sau3AI	GATC	3 cut(s)	11, 134, 234
Sau96I	GGNCC	2 cut(s)	257, 385
ScrFI	CCNGG	1 cut(s)	43
SduI	GDGCHC	1 cut(s)	224
SetI	ASST	3 cut(s)	59, 170, 424
SfaNI	GCATC	1 cut(s)	151
SfcI	CTRYAG	1 cut(s)	27
SmiMI	CAYNNNNRTG	1 cut(s)	73
Sse9I	AATT	2 cut(s)	151, 247
SsiI	CCGC	2 cut(s)	238, 348
SspMI	CTAG	1 cut(s)	442
StyD4I	CCNGG	1 cut(s)	41
TaaI	ACNGT	1 cut(s)	9
TaiI	ACGT	1 cut(s)	170
TaqI	TCGA	2 cut(s)	344, 407
TasI	AATT	2 cut(s)	151, 247
TauI	GCSGC	1 cut(s)	351
TfiI	GAWTC	1 cut(s)	300
Tru1I	TTAA	2 cut(s)	246, 455
Tru9I	TTAA	2 cut(s)	246, 455
TscAI	CASTG	1 cut(s)	56
TseFI	GTSAC	1 cut(s)	287
TseI	GCWGC	3 cut(s)	201, 240, 401
Tsp45I	GTSAC	1 cut(s)	287
TspDTI	ATGAA	1 cut(s)	91
TspGWI	ACGGA	1 cut(s)	171
TspRI	CASTG	1 cut(s)	56
XceI	RCATGY	1 cut(s)	279
XmiI	GTMKAC	1 cut(s)	407
XspI	CTAG	1 cut(s)	442
Zsp2I	ATGCAT	1 cut(s)	281

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.