Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028740.1

Orthogroup ID

OG0002949

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 3131

Gene Structure 3130 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028740.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 892 bp

atggtaaaactgagggctatggagttttggtatgccgttttcggattgttttcccttttcgttattgggaaggctgatgtttatattgtgactgtcgaaggagagcctattgtaaggtatagaggtgatgttgctggttttgaagccactgctgtggaatctgatgaaaagatcgacaccactagtgaatcagtcacgtcctatgctcgacaccttgagaataaagatgatatgcttcttggaatgctgtttgagcaagggacctacaagaagctctccagctatcagcatcttataaatggctttgcagttcatatttctcctgagcaggcagaaagactactgcgtgctccgggtgtgaaatccgtggagagagattggaaggtccggaggcttacaactcacacaccacagtttttagggcttccaacgggagtatggccaacaggaggtggctttgatagggctggagaaaatattgtgatagggtttgtggactcggggatttaccctcatcatccaagctttgcaagccccagtactgatccttatgggcctgttcccaagtacagaggtacatgtgaagttgacccagacaccaagaagagcttctgtaacggaaagattattggagcccaccatttcgccaaagctgcaatagcagctggggtgtttaatccagttattgatttcgcctctcctatggatggtgatggacatggaagtcacactgcagctattgcagctggaaacaatggaattcctgtcagaatgcatggccatgaatttggcaaagcaagtgggatggctccccgtgccagaattgctgtatataaagctctttacaggctctttggagggtttgtagcagatgtagtagccgcaattgatc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004175 GO:0004252 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008236 GO:0016787 GO:0017171 GO:0019538 GO:0043170 GO:0044238 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Inhibitor_I9 PA Peptidase_S8 fn3_5

Protein Analysis

297

Amino Acids

32.25

Weight (kDa)

6.64

Isoelectric Point (pI)

22.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002949)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G19170 AT2G19170 AT4G30020 AT4G30020 AT4G30020 AT4G30020
fragaria_vesca	FvH4_4g07370 FvH4_4g07370 FvH4_4g07370 FvH4_4g07370 FvH4_4g07370 FvH4_4g07370 FvH4_4g07370 FvH4_4g07370 FvH4_4g07370
malus_domestica	MD13G1242900.v1.1 MD16G1249700.v1.1
prunus_persica	Prupe.1G076600_v2.0.a1 Prupe.1G076600_v2.0.a1 Prupe.1G076600_v2.0.a1 Prupe.1G076600_v2.0.a1
pyrus_communis	pycom13g21460 pycom16g20920 pycom16g20930
rosa_chinensis	RchiOBHm_Chr4g0399741 RchiOBHm_Chr4g0399751
rosa_laevigata	RLG00000009242
rosa_multiflora	Rmu_sc0005299.1_g000011 Rmu_sc0028740.1_g000001
rosa_roxburghii	Rroxscaffold_5G00344690
rosa_rugosa	Rorug04G0018500 Rorug04G0018600 Rorug04G0018700
rosa_samantha	Rh4AG096300 Rh4BG093700 Rh4CG105200 Rh4DG090100
rosa_wichuraiana	Rw4G007960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	296
AasI	GACNNNNNNGTC	1 cut(s)	723
AccIII	TCCGGA	1 cut(s)	387
AciI	CCGC	1 cut(s)	882
AclWI	GGATC	1 cut(s)	539
AcoI	YGGCCR	2 cut(s)	440, 778
AcsI	RAATTY	2 cut(s)	759, 785
AfaI	GTAC	3 cut(s)	541, 569, 577
AfiI	CCNNNNNNNGG	2 cut(s)	449, 707
AflIII	ACRYGT	1 cut(s)	578
AgsI	TTSAA	1 cut(s)	143
AhlI	ACTAGT	1 cut(s)	182
AjiI	CACGTC	1 cut(s)	198
AjuI	GAANNNNNNNTTGG	2 cut(s)	593, 625
AleI	CACNNNNGTG	1 cut(s)	152
AluBI	AGCT	9 cut(s)	274, 282, 525, 609, 653, 665, 737, 746, 839
AluI	AGCT	9 cut(s)	274, 282, 525, 609, 653, 665, 737, 746, 839
Alw21I	GWGCWC	1 cut(s)	352
AlwI	GGATC	1 cut(s)	539
Ama87I	CYCGRG	1 cut(s)	499
Aor13HI	TCCGGA	1 cut(s)	387
AoxI	GGCC	3 cut(s)	440, 554, 778
ApeKI	GCWGC	4 cut(s)	653, 662, 734, 743
ApoI	RAATTY	2 cut(s)	759, 785
Asp700I	GAANNNNTTC	1 cut(s)	608
AspS9I	GGNCC	3 cut(s)	261, 385, 554
AsuC2I	CCSGG	1 cut(s)	354
AsuHPI	GGTGA	2 cut(s)	137, 722
AvaI	CYCGRG	1 cut(s)	499
AvaII	GGWCC	2 cut(s)	261, 385
BalI	TGGCCA	2 cut(s)	442, 780
BanII	GRGCYC	1 cut(s)	637
Bbv12I	GWGCWC	1 cut(s)	352
BbvI	GCAGC	4 cut(s)	640, 674, 746, 755
BccI	CCATC	3 cut(s)	701, 707, 799
BceAI	ACGGC	1 cut(s)	20
BcnI	CCSGG	1 cut(s)	354
BcuI	ACTAGT	1 cut(s)	182
BfaI	CTAG	1 cut(s)	183
BfmI	CTRYAG	1 cut(s)	732
BisI	GCNGC	5 cut(s)	654, 663, 735, 744, 882
BlsI	GCNGC	5 cut(s)	655, 664, 736, 745, 883
BmcAI	AGTACT	1 cut(s)	541
Bme1390I	CCNGG	1 cut(s)	354
Bme18I	GGWCC	2 cut(s)	261, 385
BmeT110I	CYCGRG	1 cut(s)	499
BmgBI	CACGTC	1 cut(s)	198
BmgT120I	GGNCC	3 cut(s)	261, 385, 554
BmiI	GGNNCC	3 cut(s)	262, 634, 810
BmrFI	CCNGG	1 cut(s)	354
BmrI	ACTGGG	1 cut(s)	531
BmsI	GCATC	1 cut(s)	298
BmuI	ACTGGG	1 cut(s)	531
BpmI	CTGGAG	2 cut(s)	262, 489
Bpu10I	CCTNAGC	1 cut(s)	324
BpuEI	CTTGAG	1 cut(s)	236
BpuMI	CCSGG	1 cut(s)	354
BsaJI	CCNNGG	1 cut(s)	366
BsaWI	WCCGGW	1 cut(s)	387
BsaXI	ACNNNNNCTCC	4 cut(s)	14, 44, 849, 879
Bsc4I	CCNNNNNNNGG	2 cut(s)	449, 707
Bse1I	ACTGG	2 cut(s)	537, 680
BseAI	TCCGGA	1 cut(s)	387
BseDI	CCNNGG	1 cut(s)	366
BseGI	GGATG	3 cut(s)	517, 712, 810
BseLI	CCNNNNNNNGG	2 cut(s)	449, 707
BseMII	CTCAG	1 cut(s)	315
BseNI	ACTGG	2 cut(s)	537, 680
BseXI	GCAGC	4 cut(s)	640, 674, 746, 755
BseYI	CCCAGC	1 cut(s)	665
BshFI	GGCC	3 cut(s)	442, 556, 780
BsiHKAI	GWGCWC	1 cut(s)	352
BsiHKCI	CYCGRG	1 cut(s)	499
BsiSI	CCGG	2 cut(s)	353, 388
BslFI	GGGAC	1 cut(s)	274
BslI	CCNNNNNNNGG	2 cut(s)	449, 707
BsmFI	GGGAC	1 cut(s)	274
BsmI	GAATGC	2 cut(s)	249, 777
BsnI	GGCC	3 cut(s)	442, 556, 780
BsoBI	CYCGRG	1 cut(s)	499
Bsp1286I	GDGCHC	2 cut(s)	352, 637
Bsp13I	TCCGGA	1 cut(s)	387
Bsp143I	GATC	2 cut(s)	171, 544
BspACI	CCGC	1 cut(s)	882
BspANI	GGCC	3 cut(s)	442, 556, 780
BspCNI	CTCAG	1 cut(s)	316
BspEI	TCCGGA	1 cut(s)	387
BspLI	GGNNCC	3 cut(s)	262, 634, 810
BspMAI	CTGCAG	1 cut(s)	736
BspPI	GGATC	1 cut(s)	539
BspQI	GCTCTTC	1 cut(s)	599
BsrI	ACTGG	2 cut(s)	537, 680
BssECI	CCNNGG	1 cut(s)	366
BssMI	GATC	2 cut(s)	171, 544
Bst4CI	ACNGT	2 cut(s)	94, 414
Bst6I	CTCTTC	1 cut(s)	599
BstAPI	GCANNNNNTGC	1 cut(s)	740
BstC8I	GCNNGC	3 cut(s)	330, 348, 532
BstDEI	CTNAG	2 cut(s)	11, 324
BstDSI	CCRYGG	1 cut(s)	366
BstF5I	GGATG	3 cut(s)	517, 712, 810
BstKTI	GATC	3 cut(s)	174, 547, 892
BstMBI	GATC	2 cut(s)	171, 544
BstMWI	GCNNNNNNNGC	9 cut(s)	253, 531, 653, 659, 662, 740, 743, 815, 824
BstNSI	RCATGY	1 cut(s)	582
BstSCI	CCNGG	1 cut(s)	352
BstSFI	CTRYAG	1 cut(s)	732
BstV1I	GCAGC	4 cut(s)	640, 674, 746, 755
BstXI	CCANNNNNNTGG	2 cut(s)	154, 788
BsuRI	GGCC	3 cut(s)	442, 556, 780
BtgI	CCRYGG	1 cut(s)	366
BtrI	CACGTC	1 cut(s)	198
BtsCI	GGATG	3 cut(s)	517, 712, 810
BtsI	GCAGTG	2 cut(s)	147, 729
BtsIMutI	CAGTG	2 cut(s)	147, 729
Cac8I	GCNNGC	3 cut(s)	330, 348, 532
Cfr13I	GGNCC	3 cut(s)	261, 385, 554
Csp6I	GTAC	3 cut(s)	540, 568, 576
CspCI	CAANNNNNGTGG	2 cut(s)	781, 816
CviAII	CATG	4 cut(s)	579, 719, 776, 782
CviQI	GTAC	3 cut(s)	540, 568, 576
DdeI	CTNAG	2 cut(s)	11, 324
DpnI	GATC	3 cut(s)	173, 546, 891
DpnII	GATC	2 cut(s)	171, 544
DrdI	GACNNNNNNGTC	1 cut(s)	723
DseDI	GACNNNNNNGTC	1 cut(s)	723
EaeI	YGGCCR	2 cut(s)	440, 778
Eam1104I	CTCTTC	1 cut(s)	599
EarI	CTCTTC	1 cut(s)	599
Eco24I	GRGCYC	1 cut(s)	637
Eco47I	GGWCC	2 cut(s)	261, 385
Eco88I	CYCGRG	1 cut(s)	499
EcoO109I	RGGNCCY	1 cut(s)	261
EcoRI	GAATTC	1 cut(s)	759
EcoT22I	ATGCAT	1 cut(s)	777
EcoT38I	GRGCYC	1 cut(s)	637
FaeI	CATG	4 cut(s)	582, 722, 779, 785
FalI	AAGNNNNNCTT	2 cut(s)	593, 625
FaqI	GGGAC	1 cut(s)	274
FatI	CATG	4 cut(s)	578, 718, 775, 781
Fnu4HI	GCNGC	5 cut(s)	654, 663, 735, 744, 882
FokI	GGATG	3 cut(s)	504, 719, 817
FriOI	GRGCYC	1 cut(s)	637
Fsp4HI	GCNGC	5 cut(s)	654, 663, 735, 744, 882
FspBI	CTAG	1 cut(s)	183
GluI	GCNGC	5 cut(s)	654, 663, 735, 744, 882
GsaI	CCCAGC	1 cut(s)	669
GsuI	CTGGAG	2 cut(s)	262, 489
HaeIII	GGCC	3 cut(s)	442, 556, 780
HapII	CCGG	2 cut(s)	353, 388
Hin1II	CATG	4 cut(s)	582, 722, 779, 785
HincII	GTYRAC	1 cut(s)	589
HindII	GTYRAC	1 cut(s)	589
HindIII	AAGCTT	1 cut(s)	523
HinfI	GANTC	3 cut(s)	158, 188, 497
HpaII	CCGG	2 cut(s)	353, 388
HphI	GGTGA	2 cut(s)	137, 722
Hpy166II	GTNNAC	2 cut(s)	496, 589
Hpy188I	TCNGA	3 cut(s)	44, 163, 770
Hpy188III	TCNNGA	2 cut(s)	323, 388
Hpy8I	GTNNAC	2 cut(s)	496, 589
HpyAV	CCTTC	3 cut(s)	64, 92, 376
HpyCH4III	ACNGT	2 cut(s)	94, 414
HpyCH4IV	ACGT	1 cut(s)	197
HpyCH4V	TGCA	6 cut(s)	308, 530, 656, 734, 743, 775
HpyF10VI	GCNNNNNNNGC	9 cut(s)	253, 531, 653, 659, 662, 740, 743, 815, 824
HpyF3I	CTNAG	2 cut(s)	11, 324
HpySE526I	ACGT	1 cut(s)	197
Hsp92II	CATG	4 cut(s)	582, 722, 779, 785
Kpn2I	TCCGGA	1 cut(s)	387
Kzo9I	GATC	2 cut(s)	171, 544
LguI	GCTCTTC	1 cut(s)	599
LmnI	GCTCC	3 cut(s)	355, 632, 814
Lsp1109I	GCAGC	4 cut(s)	640, 674, 746, 755
LweI	GCATC	1 cut(s)	298
MaeI	CTAG	1 cut(s)	183
MaeII	ACGT	1 cut(s)	197
MaeIII	GTNAC	4 cut(s)	88, 193, 614, 725
MalI	GATC	3 cut(s)	173, 546, 891
MboI	GATC	2 cut(s)	171, 544
MboII	GAAGA	1 cut(s)	616
MfeI	CAATTG	1 cut(s)	885
MhlI	GDGCHC	2 cut(s)	352, 637
MlsI	TGGCCA	2 cut(s)	442, 780
MluCI	AATT	4 cut(s)	759, 785, 822, 885
MluNI	TGGCCA	2 cut(s)	442, 780
MlyI	GAGTC	1 cut(s)	491
MmeI	TCCRAC	1 cut(s)	452
MnlI	CCTC	8 cut(s)	6, 116, 384, 443, 522, 566, 706, 851
Mox20I	TGGCCA	2 cut(s)	442, 780
Mph1103I	ATGCAT	1 cut(s)	777
MroI	TCCGGA	1 cut(s)	387
MroXI	GAANNNNTTC	1 cut(s)	608
MscI	TGGCCA	2 cut(s)	442, 780
MseI	TTAA	1 cut(s)	675
MslI	CAYNNNNRTG	2 cut(s)	152, 780
Msp20I	TGGCCA	2 cut(s)	442, 780
MspA1I	CMGCKG	2 cut(s)	665, 746
MspI	CCGG	2 cut(s)	353, 388
MspR9I	CCNGG	1 cut(s)	354
MunI	CAATTG	1 cut(s)	885
Mva1269I	GAATGC	2 cut(s)	249, 777
MwoI	GCNNNNNNNGC	9 cut(s)	253, 531, 653, 659, 662, 740, 743, 815, 824
NciI	CCSGG	1 cut(s)	354
NdeII	GATC	2 cut(s)	171, 544
NlaIII	CATG	4 cut(s)	582, 722, 779, 785
NlaIV	GGNNCC	3 cut(s)	262, 634, 810
NmuCI	GTSAC	3 cut(s)	88, 193, 725
NsiI	ATGCAT	1 cut(s)	777
NspI	RCATGY	1 cut(s)	582
OliI	CACNNNNGTG	1 cut(s)	152
PciI	ACATGT	1 cut(s)	578
PciSI	GCTCTTC	1 cut(s)	599
PctI	GAATGC	2 cut(s)	249, 777
PdmI	GAANNNNTTC	1 cut(s)	608
PfeI	GAWTC	2 cut(s)	158, 188
PkrI	GCNGC	5 cut(s)	655, 664, 736, 745, 883
PleI	GAGTC	1 cut(s)	491
PpsI	GAGTC	1 cut(s)	491
PpuMI	RGGWCCY	1 cut(s)	261
PscI	ACATGT	1 cut(s)	578
PsiI	TTATAA	1 cut(s)	296
Psp5II	RGGWCCY	1 cut(s)	261
PspFI	CCCAGC	1 cut(s)	665
PspN4I	GGNNCC	3 cut(s)	262, 634, 810
PspPI	GGNCC	3 cut(s)	261, 385, 554
PspPPI	RGGWCCY	1 cut(s)	261
PstI	CTGCAG	1 cut(s)	736
PvuII	CAGCTG	2 cut(s)	665, 746
RsaI	GTAC	3 cut(s)	541, 569, 577
RsaNI	GTAC	3 cut(s)	540, 568, 576
RseI	CAYNNNNRTG	2 cut(s)	152, 780
SapI	GCTCTTC	1 cut(s)	599
SaqAI	TTAA	1 cut(s)	675
SatI	GCNGC	5 cut(s)	654, 663, 735, 744, 882
Sau3AI	GATC	2 cut(s)	171, 544
Sau96I	GGNCC	3 cut(s)	261, 385, 554
ScaI	AGTACT	1 cut(s)	541
SchI	GAGTC	1 cut(s)	491
ScrFI	CCNGG	1 cut(s)	354
SduI	GDGCHC	2 cut(s)	352, 637
SfaNI	GCATC	1 cut(s)	298
SfcI	CTRYAG	1 cut(s)	732
SinI	GGWCC	2 cut(s)	261, 385
SmiMI	CAYNNNNRTG	2 cut(s)	152, 780
SmlI	CTYRAG	1 cut(s)	215
SmoI	CTYRAG	1 cut(s)	215
SpeI	ACTAGT	1 cut(s)	182
Sse9I	AATT	4 cut(s)	759, 785, 822, 885
SsiI	CCGC	1 cut(s)	882
SspI	AATATT	1 cut(s)	478
SspMI	CTAG	1 cut(s)	183
StyD4I	CCNGG	1 cut(s)	352
TaaI	ACNGT	2 cut(s)	94, 414
TaiI	ACGT	1 cut(s)	200
TaqI	TCGA	3 cut(s)	96, 174, 208
TasI	AATT	4 cut(s)	759, 785, 822, 885
TatI	WGTACW	2 cut(s)	539, 567
TauI	GCSGC	1 cut(s)	884
TfiI	GAWTC	2 cut(s)	158, 188
Tru1I	TTAA	1 cut(s)	675
Tru9I	TTAA	1 cut(s)	675
TscAI	CASTG	2 cut(s)	154, 736
TseFI	GTSAC	3 cut(s)	88, 193, 725
TseI	GCWGC	4 cut(s)	653, 662, 734, 743
Tsp45I	GTSAC	3 cut(s)	88, 193, 725
TspDTI	ATGAA	3 cut(s)	180, 302, 798
TspGWI	ACGGA	2 cut(s)	355, 633
TspRI	CASTG	2 cut(s)	154, 736
VpaK11BI	GGWCC	2 cut(s)	261, 385
XapI	RAATTY	2 cut(s)	759, 785
XceI	RCATGY	1 cut(s)	582
XcmI	CCANNNNNNNNNTGG	1 cut(s)	435
XmnI	GAANNNNTTC	1 cut(s)	608
XspI	CTAG	1 cut(s)	183
ZrmI	AGTACT	1 cut(s)	541
Zsp2I	ATGCAT	1 cut(s)	777

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.