Rmu_sc0031515.1_g000001

C3HC zinc finger-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031515.1
Physical Location & Seq
Reverse (-)
2 .. 598
597 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031515.1_g000001.1.cds

Sequence Viewer

Length: 515 bp
ctggattctgggcacaaaggtgcttgtccctggagaggaaacagctgcccagaaagcttggtgcaattccctcctactcctcagtctgccttaattggtggttataaggatagatgtgatggacttttgcaatttcactcactccctaaggtagctgcctctgtaattgagcaaatatgggtttctcggggtccacagattgaccgtcttctgtcccagtcccagaattttatggcaggagatgtagatattaaaccagaaagtataccagaattcgaaagctctcgagatggagcaatctgtttatattctcgtgcacagaggcttataagtctttgtggatgggaaccaagatggcttttgaatattcaagattatgaggaacattctgcccaatcagctagaaatggatattctctcgggcctagctatgctcaggtccatctttcacaggatcctggagcaagcaagaaagctatttcagcttctgctagaaaggataatggaaagagtaa

Protein Analysis

171

Amino Acids

18.73

Weight (kDa)

7.06

Isoelectric Point (pI)

57.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 105, 329
AccI GTMKAC 1 cut(s) 265
AclWI GGATC 2 cut(s) 449, 462
AcsI RAATTY 2 cut(s) 226, 272
AfiI CCNNNNNNNGG 1 cut(s) 35
AgsI TTSAA 2 cut(s) 364, 371
AjnI CCWGG 2 cut(s) 29, 457
AleI CACNNNNGTG 1 cut(s) 18
AluBI AGCT 8 cut(s) 45, 57, 155, 282, 401, 429, 476, 485
AluI AGCT 8 cut(s) 45, 57, 155, 282, 401, 429, 476, 485
Alw21I GWGCWC 1 cut(s) 319
Alw44I GTGCAC 1 cut(s) 315
AlwI GGATC 2 cut(s) 449, 462
AlwNI CAGNNNCTG 1 cut(s) 488
Ama87I CYCGRG 3 cut(s) 186, 285, 419
AoxI GGCC 1 cut(s) 422
ApaLI GTGCAC 1 cut(s) 315
ApeKI GCWGC 2 cut(s) 45, 155
ApoI RAATTY 2 cut(s) 226, 272
AspS9I GGNCC 3 cut(s) 191, 422, 439
AsuII TTCGAA 1 cut(s) 276
AvaI CYCGRG 3 cut(s) 186, 285, 419
AvaII GGWCC 2 cut(s) 191, 439
AxyI CCTNAGG 1 cut(s) 147
BaeGI GKGCMC 2 cut(s) 15, 319
BamHI GGATCC 1 cut(s) 454
BauI CACGAG 1 cut(s) 312
BbsI GAAGAC 1 cut(s) 200
Bbv12I GWGCWC 1 cut(s) 319
BbvI GCAGC 2 cut(s) 32, 142
BccI CCATC 5 cut(s) 113, 284, 336, 348, 450
BciT130I CCWGG 2 cut(s) 31, 459
BfaI CTAG 3 cut(s) 402, 426, 492
BisI GCNGC 2 cut(s) 46, 156
BlsI GCNGC 2 cut(s) 47, 157
Bme1390I CCNGG 2 cut(s) 31, 459
Bme18I GGWCC 2 cut(s) 191, 439
BmeT110I CYCGRG 3 cut(s) 186, 285, 419
BmgT120I GGNCC 3 cut(s) 191, 422, 439
BmiI GGNNCC 3 cut(s) 192, 348, 456
BmrFI CCNGG 2 cut(s) 31, 459
BmrI ACTGGG 1 cut(s) 211
BmuI ACTGGG 1 cut(s) 211
BpiI GAAGAC 1 cut(s) 200
BpmI CTGGAG 2 cut(s) 52, 480
Bpu10I CCTNAGC 1 cut(s) 435
Bpu14I TTCGAA 1 cut(s) 276
BsaJI CCNNGG 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 217
Bse21I CCTNAGG 1 cut(s) 147
BseBI CCWGG 2 cut(s) 31, 459
BseDI CCNNGG 1 cut(s) 29
BseGI GGATG 1 cut(s) 347
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMII CTCAG 2 cut(s) 95, 449
BseNI ACTGG 1 cut(s) 217
BseRI GAGGAG 1 cut(s) 69
BseSI GKGCMC 2 cut(s) 15, 319
BseXI GCAGC 2 cut(s) 32, 142
BshFI GGCC 1 cut(s) 424
BsiHKAI GWGCWC 1 cut(s) 319
BsiHKCI CYCGRG 3 cut(s) 186, 285, 419
BslFI GGGAC 3 cut(s) 12, 199, 205
BslI CCNNNNNNNGG 1 cut(s) 35
BsmFI GGGAC 3 cut(s) 12, 199, 205
BsnI GGCC 1 cut(s) 424
BsoBI CYCGRG 3 cut(s) 186, 285, 419
Bsp119I TTCGAA 1 cut(s) 276
Bsp1286I GDGCHC 2 cut(s) 15, 319
Bsp143I GATC 1 cut(s) 454
BspANI GGCC 1 cut(s) 424
BspCNI CTCAG 2 cut(s) 94, 448
BspLI GGNNCC 3 cut(s) 192, 348, 456
BspPI GGATC 2 cut(s) 449, 462
BspT104I TTCGAA 1 cut(s) 276
BsrI ACTGG 1 cut(s) 217
BssECI CCNNGG 1 cut(s) 29
BssMI GATC 1 cut(s) 454
BssNAI GTATAC 1 cut(s) 266
BssSI CACGAG 1 cut(s) 312
Bst1107I GTATAC 1 cut(s) 266
Bst2BI CACGAG 1 cut(s) 312
Bst2UI CCWGG 2 cut(s) 31, 459
Bst4CI ACNGT 1 cut(s) 206
BstBI TTCGAA 1 cut(s) 276
BstC8I GCNNGC 1 cut(s) 466
BstDEI CTNAG 3 cut(s) 81, 147, 435
BstF5I GGATG 1 cut(s) 347
BstKTI GATC 1 cut(s) 457
BstMBI GATC 1 cut(s) 454
BstMWI GCNNNNNNNGC 3 cut(s) 54, 398, 482
BstNI CCWGG 2 cut(s) 31, 459
BstSCI CCNGG 2 cut(s) 29, 457
BstSLI GKGCMC 2 cut(s) 15, 319
BstV1I GCAGC 2 cut(s) 32, 142
BstV2I GAAGAC 1 cut(s) 200
BstX2I RGATCY 1 cut(s) 454
BstYI RGATCY 1 cut(s) 454
BstZ17I GTATAC 1 cut(s) 266
Bsu36I CCTNAGG 1 cut(s) 147
BsuRI GGCC 1 cut(s) 424
BtsCI GGATG 1 cut(s) 347
Cac8I GCNNGC 1 cut(s) 466
CaiI CAGNNNCTG 1 cut(s) 488
Cfr13I GGNCC 3 cut(s) 191, 422, 439
DdeI CTNAG 3 cut(s) 81, 147, 435
DpnI GATC 1 cut(s) 456
DpnII GATC 1 cut(s) 454
Eco47I GGWCC 2 cut(s) 191, 439
Eco81I CCTNAGG 1 cut(s) 147
Eco88I CYCGRG 3 cut(s) 186, 285, 419
EcoRI GAATTC 1 cut(s) 272
EcoRII CCWGG 2 cut(s) 29, 457
FaiI YATR 8 cut(s) 105, 178, 233, 266, 307, 329, 378, 432
FaqI GGGAC 3 cut(s) 12, 199, 205
FblI GTMKAC 1 cut(s) 265
Fnu4HI GCNGC 2 cut(s) 46, 156
FokI GGATG 1 cut(s) 354
Fsp4HI GCNGC 2 cut(s) 46, 156
FspBI CTAG 3 cut(s) 402, 426, 492
GluI GCNGC 2 cut(s) 46, 156
GsuI CTGGAG 2 cut(s) 52, 480
HaeIII GGCC 1 cut(s) 424
HindIII AAGCTT 1 cut(s) 55
HinfI GANTC 1 cut(s) 5
Hpy166II GTNNAC 3 cut(s) 194, 266, 317
Hpy188III TCNNGA 3 cut(s) 285, 287, 371
Hpy8I GTNNAC 3 cut(s) 194, 266, 317
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4V TGCA 3 cut(s) 64, 130, 317
HpyF10VI GCNNNNNNNGC 3 cut(s) 54, 398, 482
HpyF3I CTNAG 3 cut(s) 81, 147, 435
Kzo9I GATC 1 cut(s) 454
LmnI GCTCC 2 cut(s) 293, 461
Lsp1109I GCAGC 2 cut(s) 32, 142
MaeI CTAG 3 cut(s) 402, 426, 492
MalI GATC 1 cut(s) 456
MboI GATC 1 cut(s) 454
MboII GAAGA 1 cut(s) 200
MflI RGATCY 1 cut(s) 454
MhlI GDGCHC 2 cut(s) 15, 319
MluCI AATT 6 cut(s) 65, 93, 131, 165, 226, 272
MnlI CCTC 6 cut(s) 29, 81, 90, 169, 315, 373
MseI TTAA 2 cut(s) 92, 252
MslI CAYNNNNRTG 1 cut(s) 18
MspA1I CMGCKG 1 cut(s) 45
MspR9I CCNGG 2 cut(s) 31, 459
MvaI CCWGG 2 cut(s) 31, 459
MwoI GCNNNNNNNGC 3 cut(s) 54, 398, 482
NdeII GATC 1 cut(s) 454
NlaIV GGNNCC 3 cut(s) 192, 348, 456
NspV TTCGAA 1 cut(s) 276
OliI CACNNNNGTG 1 cut(s) 18
PaeR7I CTCGAG 1 cut(s) 285
PfeI GAWTC 1 cut(s) 5
PfoI TCCNGGA 1 cut(s) 457
PkrI GCNGC 2 cut(s) 47, 157
PsiI TTATAA 2 cut(s) 105, 329
Psp6I CCWGG 2 cut(s) 29, 457
PspGI CCWGG 2 cut(s) 29, 457
PspN4I GGNNCC 3 cut(s) 192, 348, 456
PspPI GGNCC 3 cut(s) 191, 422, 439
PstNI CAGNNNCTG 1 cut(s) 488
PsuI RGATCY 1 cut(s) 454
PvuII CAGCTG 1 cut(s) 45
RseI CAYNNNNRTG 1 cut(s) 18
SaqAI TTAA 2 cut(s) 92, 252
SatI GCNGC 2 cut(s) 46, 156
Sau3AI GATC 1 cut(s) 454
Sau96I GGNCC 3 cut(s) 191, 422, 439
ScrFI CCNGG 2 cut(s) 31, 459
SduI GDGCHC 2 cut(s) 15, 319
Sfr274I CTCGAG 1 cut(s) 285
SfuI TTCGAA 1 cut(s) 276
SinI GGWCC 2 cut(s) 191, 439
SlaI CTCGAG 1 cut(s) 285
SmiMI CAYNNNNRTG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 285
SmoI CTYRAG 1 cut(s) 285
Sse9I AATT 6 cut(s) 65, 93, 131, 165, 226, 272
SspI AATATT 1 cut(s) 367
SspMI CTAG 3 cut(s) 402, 426, 492
StyD4I CCNGG 2 cut(s) 29, 457
TaaI ACNGT 1 cut(s) 206
TaqI TCGA 2 cut(s) 276, 286
TasI AATT 6 cut(s) 65, 93, 131, 165, 226, 272
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 2 cut(s) 92, 252
Tru9I TTAA 2 cut(s) 92, 252
TseI GCWGC 2 cut(s) 45, 155
VneI GTGCAC 1 cut(s) 315
VpaK11BI GGWCC 2 cut(s) 191, 439
XapI RAATTY 2 cut(s) 226, 272
XhoI CTCGAG 1 cut(s) 285
XmiI GTMKAC 1 cut(s) 265
XspI CTAG 3 cut(s) 402, 426, 492
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.