Rmu_sc0032992.1_g000001

Transcription termination and cleavage factor C-terminal

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032992.1
Physical Location & Seq
Reverse (-)
2 .. 171
170 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032992.1_g000001.1.cds

Sequence Viewer

Length: 170 bp
atgcatttgggttcagagtacagcaatcaagttggaacttctatgcaagcagatagaggatcttggatgtctggccctccagagagttcatcagtgccacagctttcaggaccaccatcattagttcctggtcaaatgcctggcagccagcctggtcgtggcacagcggt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

5.8

Weight (kDa)

5.43

Isoelectric Point (pI)

68.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 167
AclWI GGATC 1 cut(s) 67
AfaI GTAC 1 cut(s) 20
AfiI CCNNNNNNNGG 1 cut(s) 158
AjnI CCWGG 3 cut(s) 127, 139, 151
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
AlwI GGATC 1 cut(s) 67
AoxI GGCC 1 cut(s) 73
ApeKI GCWGC 1 cut(s) 144
AspS9I GGNCC 2 cut(s) 74, 110
AvaII GGWCC 1 cut(s) 110
BbvI GCAGC 1 cut(s) 156
BccI CCATC 1 cut(s) 124
BciT130I CCWGG 3 cut(s) 129, 141, 153
BisI GCNGC 1 cut(s) 145
BlsI GCNGC 1 cut(s) 146
Bme1390I CCNGG 3 cut(s) 129, 141, 153
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 2 cut(s) 74, 110
BmrFI CCNGG 3 cut(s) 129, 141, 153
BpmI CTGGAG 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 158
BseBI CCWGG 3 cut(s) 129, 141, 153
BseGI GGATG 1 cut(s) 72
BseLI CCNNNNNNNGG 1 cut(s) 158
BseXI GCAGC 1 cut(s) 156
BshFI GGCC 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 158
BsnI GGCC 1 cut(s) 75
Bsp143I GATC 1 cut(s) 59
BspACI CCGC 1 cut(s) 167
BspANI GGCC 1 cut(s) 75
BspPI GGATC 1 cut(s) 67
BssMI GATC 1 cut(s) 59
Bst2UI CCWGG 3 cut(s) 129, 141, 153
BstC8I GCNNGC 2 cut(s) 48, 149
BstF5I GGATG 1 cut(s) 72
BstKTI GATC 1 cut(s) 62
BstMBI GATC 1 cut(s) 59
BstNI CCWGG 3 cut(s) 129, 141, 153
BstSCI CCNGG 3 cut(s) 127, 139, 151
BstV1I GCAGC 1 cut(s) 156
BstX2I RGATCY 1 cut(s) 59
BstYI RGATCY 1 cut(s) 59
BsuRI GGCC 1 cut(s) 75
BtsCI GGATG 1 cut(s) 72
BtsIMutI CAGTG 1 cut(s) 99
Cac8I GCNNGC 2 cut(s) 48, 149
Cfr13I GGNCC 2 cut(s) 74, 110
Csp6I GTAC 1 cut(s) 19
CviJI RGCY 4 cut(s) 75, 103, 147, 151
CviKI_1 RGCY 4 cut(s) 75, 103, 147, 151
CviQI GTAC 1 cut(s) 19
DpnI GATC 1 cut(s) 61
DpnII GATC 1 cut(s) 59
Eco47I GGWCC 1 cut(s) 110
EcoRII CCWGG 3 cut(s) 127, 139, 151
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 1 cut(s) 44
Fnu4HI GCNGC 1 cut(s) 145
FokI GGATG 1 cut(s) 79
Fsp4HI GCNGC 1 cut(s) 145
GluI GCNGC 1 cut(s) 145
GsuI CTGGAG 1 cut(s) 63
HaeIII GGCC 1 cut(s) 75
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 80, 108
HpyCH4V TGCA 2 cut(s) 4, 46
Kzo9I GATC 1 cut(s) 59
Lsp1109I GCAGC 1 cut(s) 156
MalI GATC 1 cut(s) 61
MboI GATC 1 cut(s) 59
MflI RGATCY 1 cut(s) 59
MmeI TCCRAC 1 cut(s) 13
MnlI CCTC 2 cut(s) 50, 87
Mph1103I ATGCAT 1 cut(s) 6
MspA1I CMGCKG 1 cut(s) 167
MspR9I CCNGG 3 cut(s) 129, 141, 153
MvaI CCWGG 3 cut(s) 129, 141, 153
NdeII GATC 1 cut(s) 59
NsiI ATGCAT 1 cut(s) 6
PkrI GCNGC 1 cut(s) 146
Psp6I CCWGG 3 cut(s) 127, 139, 151
PspGI CCWGG 3 cut(s) 127, 139, 151
PspPI GGNCC 2 cut(s) 74, 110
PsuI RGATCY 1 cut(s) 59
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
SatI GCNGC 1 cut(s) 145
Sau3AI GATC 1 cut(s) 59
Sau96I GGNCC 2 cut(s) 74, 110
ScrFI CCNGG 3 cut(s) 129, 141, 153
SetI ASST 1 cut(s) 105
SinI GGWCC 1 cut(s) 110
SsiI CCGC 1 cut(s) 167
StyD4I CCNGG 3 cut(s) 127, 139, 151
TatI WGTACW 1 cut(s) 18
TscAI CASTG 1 cut(s) 99
TseI GCWGC 1 cut(s) 144
TspDTI ATGAA 1 cut(s) 78
TspRI CASTG 1 cut(s) 99
VpaK11BI GGWCC 1 cut(s) 110
XcmI CCANNNNNNNNNTGG 1 cut(s) 155
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.