Rmu_sc0036488.1_g000001

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0036488.1
Physical Location & Seq
Forward (+)
1 .. 534
534 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0036488.1_g000001.1.cds

Sequence Viewer

Length: 286 bp
tgattatttcgttcacagcgataagacttacctgttaagtggttctgatgacttcactgccaaggtatgggactatgaaactacaagttgtgtgcaaactctagaaggtcatgagaacaatgtaacaactgtgagtgtacatcctgagcttcccataataattacaacttctgaggatgggactgttcatatatggaatgcaaccacatttagtctagagcacaaactgaactatggtcttgaaagagtttgggccattggacacatgaaaggatcatacaagtaa

Protein Analysis

94

Amino Acids

10.68

Weight (kDa)

5.12

Isoelectric Point (pI)

19.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 67
AclWI GGATC 1 cut(s) 281
AfaI GTAC 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 67
AgsI TTSAA 1 cut(s) 243
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
Alw21I GWGCWC 1 cut(s) 223
AlwI GGATC 1 cut(s) 281
AoxI GGCC 1 cut(s) 253
AspS9I GGNCC 1 cut(s) 253
Bbv12I GWGCWC 1 cut(s) 223
BccI CCATC 1 cut(s) 171
BfaI CTAG 2 cut(s) 102, 216
BmgT120I GGNCC 1 cut(s) 253
Bpu10I CCTNAGC 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 61
Bsc4I CCNNNNNNNGG 1 cut(s) 67
BseDI CCNNGG 1 cut(s) 61
BseGI GGATG 2 cut(s) 140, 182
BseLI CCNNNNNNNGG 1 cut(s) 67
BseMII CTCAG 2 cut(s) 136, 163
BshFI GGCC 1 cut(s) 255
BsiHKAI GWGCWC 1 cut(s) 223
BslFI GGGAC 2 cut(s) 84, 194
BslI CCNNNNNNNGG 1 cut(s) 67
BsmFI GGGAC 2 cut(s) 84, 194
BsmI GAATGC 1 cut(s) 203
BsnI GGCC 1 cut(s) 255
Bsp1286I GDGCHC 1 cut(s) 223
Bsp1407I TGTACA 1 cut(s) 137
Bsp143I GATC 1 cut(s) 273
BspANI GGCC 1 cut(s) 255
BspCNI CTCAG 2 cut(s) 137, 164
BspHI TCATGA 1 cut(s) 110
BspPI GGATC 1 cut(s) 281
BsrGI TGTACA 1 cut(s) 137
BssECI CCNNGG 1 cut(s) 61
BssMI GATC 1 cut(s) 273
BssT1I CCWWGG 1 cut(s) 61
Bst4CI ACNGT 2 cut(s) 131, 185
BstAUI TGTACA 1 cut(s) 137
BstDEI CTNAG 2 cut(s) 145, 172
BstF5I GGATG 2 cut(s) 140, 182
BstKTI GATC 1 cut(s) 276
BstMBI GATC 1 cut(s) 273
BsuRI GGCC 1 cut(s) 255
BtsCI GGATG 2 cut(s) 140, 182
BtsI GCAGTG 1 cut(s) 55
BtsIMutI CAGTG 1 cut(s) 55
CciI TCATGA 1 cut(s) 110
Cfr13I GGNCC 1 cut(s) 253
Csp6I GTAC 1 cut(s) 138
CviAII CATG 2 cut(s) 111, 266
CviJI RGCY 2 cut(s) 149, 255
CviKI_1 RGCY 2 cut(s) 149, 255
CviQI GTAC 1 cut(s) 138
DdeI CTNAG 2 cut(s) 145, 172
DpnI GATC 1 cut(s) 275
DpnII GATC 1 cut(s) 273
Eco130I CCWWGG 1 cut(s) 61
EcoT14I CCWWGG 1 cut(s) 61
ErhI CCWWGG 1 cut(s) 61
FaeI CATG 2 cut(s) 114, 269
FaqI GGGAC 2 cut(s) 84, 194
FatI CATG 2 cut(s) 110, 265
FokI GGATG 2 cut(s) 127, 189
FspBI CTAG 2 cut(s) 102, 216
HaeIII GGCC 1 cut(s) 255
Hin1II CATG 2 cut(s) 114, 269
Hpy166II GTNNAC 2 cut(s) 14, 138
Hpy188I TCNGA 2 cut(s) 47, 173
Hpy188III TCNNGA 5 cut(s) 102, 111, 144, 216, 240
Hpy8I GTNNAC 2 cut(s) 14, 138
HpyAV CCTTC 1 cut(s) 99
HpyCH4III ACNGT 2 cut(s) 131, 185
HpyCH4V TGCA 2 cut(s) 95, 201
HpyF3I CTNAG 2 cut(s) 145, 172
Hsp92II CATG 2 cut(s) 114, 269
Kzo9I GATC 1 cut(s) 273
LpnPI CCDG 2 cut(s) 45, 157
MaeI CTAG 2 cut(s) 102, 216
MaeIII GTNAC 1 cut(s) 122
MalI GATC 1 cut(s) 275
MboI GATC 1 cut(s) 273
MhlI GDGCHC 1 cut(s) 223
MluCI AATT 1 cut(s) 160
MnlI CCTC 1 cut(s) 167
MseI TTAA 1 cut(s) 36
Mva1269I GAATGC 1 cut(s) 203
NdeII GATC 1 cut(s) 273
NlaIII CATG 2 cut(s) 114, 269
PagI TCATGA 1 cut(s) 110
PcsI WCGNNNNNNNCGW 1 cut(s) 16
PctI GAATGC 1 cut(s) 203
PflMI CCANNNNNTGG 1 cut(s) 67
PspPI GGNCC 1 cut(s) 253
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SaqAI TTAA 1 cut(s) 36
Sau3AI GATC 1 cut(s) 273
Sau96I GGNCC 1 cut(s) 253
SduI GDGCHC 1 cut(s) 223
SetI ASST 4 cut(s) 34, 67, 110, 151
SgeI CNNG 9 cut(s) 44, 74, 97, 114, 123, 156, 228, 252, 278
Sse9I AATT 1 cut(s) 160
SspMI CTAG 2 cut(s) 102, 216
StyI CCWWGG 1 cut(s) 61
TaaI ACNGT 2 cut(s) 131, 185
TasI AATT 1 cut(s) 160
TatI WGTACW 1 cut(s) 137
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
TscAI CASTG 1 cut(s) 62
TspDTI ATGAA 3 cut(s) 91, 177, 282
TspRI CASTG 1 cut(s) 62
Van91I CCANNNNNTGG 1 cut(s) 67
XbaI TCTAGA 2 cut(s) 101, 215
XspI CTAG 2 cut(s) 102, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.