Rmu_sc0037952.1_g000001

Dolichyl-phosphate

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037952.1
OG0011278
Physical Location & Seq
Forward (+)
1 .. 2079
2079 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037952.1_g000001.1.cds

Sequence Viewer

Length: 688 bp
ttatctccaacaacgtgcagccaaggataagtcattttcttacgaggtggttatcgttgatgatggaagtgttgatgggacaaaaagagtagcatatgaatttgtaaagaaatacactgtagacaatgtgagggttatcctgcttggaagaaatcatggaaagggagaggctatcagaaaaggaatgcttcattcaaggggtgagctacttctaatgctggatgcagatggagcaacaaaggttgatgatgtagaaaaacttgaaaaaaagatccatgcagttgcaagtgaggaatttaagtttggggactcacctgctagtaattcagattttagaatatctgatatcccaattgctgcatttggttcccgtgctcatctcgaggagaaggccttggcttcaaggaagtggtaccgcaatttcttgatgaaaggtttccatcttgtggttcttttggctgctggtcctggaattcgtgatacccagtgtggttttaagatgttcactagggctgctgcaaggaagcttttcactaacatccgtttgaagaggtggtgctttgatgttgagttggttttcctaggcaatcggtttcgaattccgatgtgtgaaatatctgtgaactggtctgaaattcctgggtcaaaggtgaacctattaagcattccaaatatgctttgggagctt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00510 ko01100 map00510 map01100
Pfam Domains
Protein Families
Glycos_transf_2

Protein Analysis

229

Amino Acids

25.96

Weight (kDa)

9.4

Isoelectric Point (pI)

19.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011278)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G39630
fragaria_vesca FvH4_7g22450 FvH4_7g22450
malus_domestica MD01G1133900.v1.1 MD07G1198100.v1.1
prunus_persica Prupe.2G235200_v2.0.a1
pyrus_communis pycom01g15470 pycom07g18530
rosa_chinensis RchiOBHm_Chr1g0367061
rosa_laevigata RLG00000027302
rosa_multiflora Rmu_sc0037952.1_g000001 Rmu_sc0037953.1_g000001
rosa_roxburghii Rroxscaffold_4G00289650
rosa_rugosa Rorug01G0334200 Rorug01G0334300
rosa_samantha Rh1AG341100 Rh1BG301600 Rh1CG317800 Rh1DG334000
rosa_wichuraiana Rw1G030300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 323
Acc36I ACCTGC 1 cut(s) 323
Acc65I GGTACC 1 cut(s) 412
AccB1I GGYRCC 1 cut(s) 412
AccB7I CCANNNNNTGG 1 cut(s) 446
AccI GTMKAC 1 cut(s) 121
AciI CCGC 1 cut(s) 416
AclWI GGATC 1 cut(s) 266
AcsI RAATTY 5 cut(s) 99, 294, 472, 598, 634
AfaI GTAC 1 cut(s) 414
AfiI CCNNNNNNNGG 1 cut(s) 446
AgsI TTSAA 4 cut(s) 196, 264, 403, 548
AjnI CCWGG 2 cut(s) 467, 638
AjuI GAANNNNNNNTTGG 2 cut(s) 286, 318
AluBI AGCT 3 cut(s) 206, 527, 686
AluI AGCT 3 cut(s) 206, 527, 686
Alw21I GWGCWC 1 cut(s) 377
AlwI GGATC 1 cut(s) 266
Ama87I CYCGRG 1 cut(s) 381
AoxI GGCC 1 cut(s) 391
ApeKI GCWGC 5 cut(s) 18, 357, 459, 513, 516
ApoI RAATTY 5 cut(s) 99, 294, 472, 598, 634
Asp700I GAANNNNTTC 2 cut(s) 435, 528
Asp718I GGTACC 1 cut(s) 412
AspA2I CCTAGG 1 cut(s) 581
AspS9I GGNCC 1 cut(s) 465
AsuHPI GGTGA 3 cut(s) 213, 304, 662
AsuII TTCGAA 1 cut(s) 596
AvaI CYCGRG 1 cut(s) 381
AvaII GGWCC 1 cut(s) 465
AvrII CCTAGG 1 cut(s) 581
BanI GGYRCC 1 cut(s) 412
Bbv12I GWGCWC 1 cut(s) 377
BbvI GCAGC 5 cut(s) 30, 344, 446, 500, 503
BccI CCATC 4 cut(s) 57, 69, 222, 448
BciT130I CCWGG 2 cut(s) 469, 640
BfaI CTAG 3 cut(s) 319, 508, 582
BfmI CTRYAG 1 cut(s) 118
BfuAI ACCTGC 1 cut(s) 323
BisI GCNGC 5 cut(s) 19, 358, 460, 514, 517
BlnI CCTAGG 1 cut(s) 581
BlsI GCNGC 5 cut(s) 20, 359, 461, 515, 518
Bme1390I CCNGG 2 cut(s) 469, 640
Bme18I GGWCC 1 cut(s) 465
BmeT110I CYCGRG 1 cut(s) 381
BmgT120I GGNCC 1 cut(s) 465
BmiI GGNNCC 2 cut(s) 368, 414
BmrFI CCNGG 2 cut(s) 469, 640
BmrI ACTGGG 1 cut(s) 479
BmsI GCATC 1 cut(s) 212
BmuI ACTGGG 1 cut(s) 479
Bpu14I TTCGAA 1 cut(s) 596
BsaJI CCNNGG 4 cut(s) 22, 394, 581, 639
Bsc4I CCNNNNNNNGG 1 cut(s) 446
Bse1I ACTGG 2 cut(s) 485, 630
BseBI CCWGG 2 cut(s) 469, 640
BseDI CCNNGG 4 cut(s) 22, 394, 581, 639
BseGI GGATG 2 cut(s) 227, 538
BseLI CCNNNNNNNGG 1 cut(s) 446
BseNI ACTGG 2 cut(s) 485, 630
BseRI GAGGAG 1 cut(s) 399
BseXI GCAGC 5 cut(s) 30, 344, 446, 500, 503
BsgI GTGCAG 1 cut(s) 37
BshFI GGCC 1 cut(s) 393
BshNI GGYRCC 1 cut(s) 412
BsiHKAI GWGCWC 1 cut(s) 377
BsiHKCI CYCGRG 1 cut(s) 381
BslFI GGGAC 2 cut(s) 92, 321
BslI CCNNNNNNNGG 1 cut(s) 446
BsmFI GGGAC 2 cut(s) 92, 321
BsmI GAATGC 2 cut(s) 190, 664
BsnI GGCC 1 cut(s) 393
BsoBI CYCGRG 1 cut(s) 381
Bsp119I TTCGAA 1 cut(s) 596
Bsp1286I GDGCHC 1 cut(s) 377
Bsp143I GATC 1 cut(s) 271
BspACI CCGC 1 cut(s) 416
BspANI GGCC 1 cut(s) 393
BspLI GGNNCC 2 cut(s) 368, 414
BspMI ACCTGC 1 cut(s) 323
BspPI GGATC 1 cut(s) 266
BspT104I TTCGAA 1 cut(s) 596
BspT107I GGYRCC 1 cut(s) 412
BsrI ACTGG 2 cut(s) 485, 630
BssECI CCNNGG 4 cut(s) 22, 394, 581, 639
BssMI GATC 1 cut(s) 271
BssT1I CCWWGG 3 cut(s) 22, 394, 581
Bst2UI CCWGG 2 cut(s) 469, 640
Bst4CI ACNGT 1 cut(s) 119
Bst6I CTCTTC 1 cut(s) 543
BstBI TTCGAA 1 cut(s) 596
BstF5I GGATG 2 cut(s) 227, 538
BstKTI GATC 1 cut(s) 274
BstMBI GATC 1 cut(s) 271
BstMWI GCNNNNNNNGC 2 cut(s) 231, 683
BstNI CCWGG 2 cut(s) 469, 640
BstSCI CCNGG 2 cut(s) 467, 638
BstSFI CTRYAG 1 cut(s) 118
BstV1I GCAGC 5 cut(s) 30, 344, 446, 500, 503
BstX2I RGATCY 1 cut(s) 271
BstYI RGATCY 1 cut(s) 271
BsuRI GGCC 1 cut(s) 393
BtsCI GGATG 2 cut(s) 227, 538
BtsIMutI CAGTG 2 cut(s) 115, 492
BveI ACCTGC 1 cut(s) 323
Cfr13I GGNCC 1 cut(s) 465
Csp6I GTAC 1 cut(s) 413
CviAII CATG 2 cut(s) 156, 276
CviJI RGCY 9 cut(s) 21, 171, 206, 393, 399, 459, 513, 527, 686
CviKI_1 RGCY 9 cut(s) 21, 171, 206, 393, 399, 459, 513, 527, 686
CviQI GTAC 1 cut(s) 413
DpnI GATC 1 cut(s) 273
DpnII GATC 1 cut(s) 271
Eam1104I CTCTTC 1 cut(s) 543
EarI CTCTTC 1 cut(s) 543
Eco130I CCWWGG 3 cut(s) 22, 394, 581
Eco147I AGGCCT 1 cut(s) 393
Eco32I GATATC 1 cut(s) 347
Eco47I GGWCC 1 cut(s) 465
Eco88I CYCGRG 1 cut(s) 381
EcoRI GAATTC 2 cut(s) 472, 598
EcoRII CCWGG 2 cut(s) 467, 638
EcoRV GATATC 1 cut(s) 347
EcoT14I CCWWGG 3 cut(s) 22, 394, 581
ErhI CCWWGG 3 cut(s) 22, 394, 581
FaeI CATG 2 cut(s) 159, 279
FaiI YATR 5 cut(s) 95, 97, 157, 277, 675
FalI AAGNNNNNCTT 2 cut(s) 172, 204
FaqI GGGAC 2 cut(s) 92, 321
FatI CATG 2 cut(s) 155, 275
FauNDI CATATG 1 cut(s) 95
FblI GTMKAC 1 cut(s) 121
Fnu4HI GCNGC 5 cut(s) 19, 358, 460, 514, 517
FokI GGATG 2 cut(s) 234, 525
Fsp4HI GCNGC 5 cut(s) 19, 358, 460, 514, 517
FspBI CTAG 3 cut(s) 319, 508, 582
GluI GCNGC 5 cut(s) 19, 358, 460, 514, 517
HaeIII GGCC 1 cut(s) 393
Hin1II CATG 2 cut(s) 159, 279
HindIII AAGCTT 1 cut(s) 525
HinfI GANTC 1 cut(s) 309
HphI GGTGA 3 cut(s) 213, 304, 662
Hpy166II GTNNAC 4 cut(s) 122, 505, 623, 653
Hpy188I TCNGA 5 cut(s) 177, 329, 344, 604, 632
Hpy188III TCNNGA 3 cut(s) 381, 425, 477
Hpy8I GTNNAC 4 cut(s) 122, 505, 623, 653
HpyAV CCTTC 1 cut(s) 383
HpyCH4III ACNGT 1 cut(s) 119
HpyCH4IV ACGT 1 cut(s) 14
HpyCH4V TGCA 6 cut(s) 18, 225, 279, 285, 360, 519
HpyF10VI GCNNNNNNNGC 2 cut(s) 231, 683
HpySE526I ACGT 1 cut(s) 14
Hsp92II CATG 2 cut(s) 159, 279
KpnI GGTACC 1 cut(s) 416
Kzo9I GATC 1 cut(s) 271
LmnI GCTCC 2 cut(s) 231, 683
Lsp1109I GCAGC 5 cut(s) 30, 344, 446, 500, 503
LweI GCATC 1 cut(s) 212
MaeI CTAG 3 cut(s) 319, 508, 582
MaeII ACGT 1 cut(s) 14
MalI GATC 1 cut(s) 273
MboI GATC 1 cut(s) 271
MboII GAAGA 2 cut(s) 160, 560
MfeI CAATTG 1 cut(s) 352
MflI RGATCY 1 cut(s) 271
MhlI GDGCHC 1 cut(s) 377
MluCI AATT 8 cut(s) 99, 294, 323, 352, 419, 472, 598, 634
MlyI GAGTC 1 cut(s) 303
MmeI TCCRAC 1 cut(s) 32
MnlI CCTC 6 cut(s) 38, 124, 161, 284, 377, 544
MroXI GAANNNNTTC 2 cut(s) 435, 528
MseI TTAA 3 cut(s) 298, 496, 660
MspR9I CCNGG 2 cut(s) 469, 640
MunI CAATTG 1 cut(s) 352
Mva1269I GAATGC 2 cut(s) 190, 664
MvaI CCWGG 2 cut(s) 469, 640
MwoI GCNNNNNNNGC 2 cut(s) 231, 683
NdeI CATATG 1 cut(s) 95
NdeII GATC 1 cut(s) 271
NlaIII CATG 2 cut(s) 159, 279
NlaIV GGNNCC 2 cut(s) 368, 414
NspV TTCGAA 1 cut(s) 596
PaeR7I CTCGAG 1 cut(s) 381
PaqCI CACCTGC 1 cut(s) 323
PceI AGGCCT 1 cut(s) 393
PctI GAATGC 2 cut(s) 190, 664
PdmI GAANNNNTTC 2 cut(s) 435, 528
PflMI CCANNNNNTGG 1 cut(s) 446
PfoI TCCNGGA 1 cut(s) 467
PkrI GCNGC 5 cut(s) 20, 359, 461, 515, 518
PleI GAGTC 1 cut(s) 303
PpsI GAGTC 1 cut(s) 303
Psp6I CCWGG 2 cut(s) 467, 638
PspGI CCWGG 2 cut(s) 467, 638
PspN4I GGNNCC 2 cut(s) 368, 414
PspPI GGNCC 1 cut(s) 465
PsuI RGATCY 1 cut(s) 271
RsaI GTAC 1 cut(s) 414
RsaNI GTAC 1 cut(s) 413
SaqAI TTAA 3 cut(s) 298, 496, 660
SatI GCNGC 5 cut(s) 19, 358, 460, 514, 517
Sau3AI GATC 1 cut(s) 271
Sau96I GGNCC 1 cut(s) 465
SchI GAGTC 1 cut(s) 303
ScrFI CCNGG 2 cut(s) 469, 640
SduI GDGCHC 1 cut(s) 377
SfaNI GCATC 1 cut(s) 212
SfcI CTRYAG 1 cut(s) 118
Sfr274I CTCGAG 1 cut(s) 381
SfuI TTCGAA 1 cut(s) 596
SinI GGWCC 1 cut(s) 465
SlaI CTCGAG 1 cut(s) 381
SmlI CTYRAG 1 cut(s) 381
SmoI CTYRAG 1 cut(s) 381
Sse9I AATT 8 cut(s) 99, 294, 323, 352, 419, 472, 598, 634
SseBI AGGCCT 1 cut(s) 393
SsiI CCGC 1 cut(s) 416
SspMI CTAG 3 cut(s) 319, 508, 582
StuI AGGCCT 1 cut(s) 393
StyD4I CCNGG 2 cut(s) 467, 638
StyI CCWWGG 3 cut(s) 22, 394, 581
TaaI ACNGT 1 cut(s) 119
TaiI ACGT 1 cut(s) 17
TaqI TCGA 2 cut(s) 382, 596
TasI AATT 8 cut(s) 99, 294, 323, 352, 419, 472, 598, 634
Tru1I TTAA 3 cut(s) 298, 496, 660
Tru9I TTAA 3 cut(s) 298, 496, 660
TscAI CASTG 2 cut(s) 122, 492
TseI GCWGC 5 cut(s) 18, 357, 459, 513, 516
TspDTI ATGAA 3 cut(s) 112, 180, 444
TspGWI ACGGA 1 cut(s) 531
TspRI CASTG 2 cut(s) 122, 492
Van91I CCANNNNNTGG 1 cut(s) 446
VpaK11BI GGWCC 1 cut(s) 465
XapI RAATTY 5 cut(s) 99, 294, 472, 598, 634
XcmI CCANNNNNNNNNTGG 1 cut(s) 676
XhoI CTCGAG 1 cut(s) 381
XmaJI CCTAGG 1 cut(s) 581
XmiI GTMKAC 1 cut(s) 121
XmnI GAANNNNTTC 2 cut(s) 435, 528
XspI CTAG 3 cut(s) 319, 508, 582
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.