Rmu_sc0037953.1_g000001

Dolichyl-phosphate

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037953.1
OG0011278
Physical Location & Seq
Forward (+)
1 .. 597
597 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037953.1_g000001.1.cds

Sequence Viewer

Length: 260 bp
tgaaaggtttccatcttgtggttcttttggctgctggtcctggaattcgtgatacccagtgtggttttaagatgttcactagggctgctgcaaggaagcttttcactaacatccgtttgaagaggtggtgttttgatgttgagttggttttcctaggcaatcggtttcgaattccgatgcgtgagatatctgtgaactggtctgaaattcctgggtcaaaggtgaacctattaagcattccaaatatgctttgggagctt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00510 ko01100 map00510 map01100
Pfam Domains
Protein Families
Glycos_transf_2

Protein Analysis

86

Amino Acids

9.94

Weight (kDa)

10.51

Isoelectric Point (pI)

23.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011278)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G39630
fragaria_vesca FvH4_7g22450 FvH4_7g22450
malus_domestica MD01G1133900.v1.1 MD07G1198100.v1.1
prunus_persica Prupe.2G235200_v2.0.a1
pyrus_communis pycom01g15470 pycom07g18530
rosa_chinensis RchiOBHm_Chr1g0367061
rosa_laevigata RLG00000027302
rosa_multiflora Rmu_sc0037952.1_g000001 Rmu_sc0037953.1_g000001
rosa_roxburghii Rroxscaffold_4G00289650
rosa_rugosa Rorug01G0334200 Rorug01G0334300
rosa_samantha Rh1AG341100 Rh1BG301600 Rh1CG317800 Rh1DG334000
rosa_wichuraiana Rw1G030300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 18
AcsI RAATTY 3 cut(s) 44, 170, 206
AfiI CCNNNNNNNGG 1 cut(s) 18
AgsI TTSAA 1 cut(s) 120
AjnI CCWGG 2 cut(s) 39, 210
AluBI AGCT 2 cut(s) 99, 258
AluI AGCT 2 cut(s) 99, 258
ApeKI GCWGC 3 cut(s) 31, 85, 88
ApoI RAATTY 3 cut(s) 44, 170, 206
Asp700I GAANNNNTTC 2 cut(s) 7, 100
AspA2I CCTAGG 1 cut(s) 153
AspS9I GGNCC 1 cut(s) 37
AsuHPI GGTGA 1 cut(s) 234
AsuII TTCGAA 1 cut(s) 168
AvaII GGWCC 1 cut(s) 37
AvrII CCTAGG 1 cut(s) 153
BbvI GCAGC 3 cut(s) 18, 72, 75
BccI CCATC 1 cut(s) 20
BciT130I CCWGG 2 cut(s) 41, 212
BfaI CTAG 2 cut(s) 80, 154
BisI GCNGC 3 cut(s) 32, 86, 89
BlnI CCTAGG 1 cut(s) 153
BlsI GCNGC 3 cut(s) 33, 87, 90
Bme1390I CCNGG 2 cut(s) 41, 212
Bme18I GGWCC 1 cut(s) 37
BmgT120I GGNCC 1 cut(s) 37
BmrFI CCNGG 2 cut(s) 41, 212
BmrI ACTGGG 1 cut(s) 51
BmsI GCATC 1 cut(s) 167
BmuI ACTGGG 1 cut(s) 51
Bpu14I TTCGAA 1 cut(s) 168
BsaJI CCNNGG 2 cut(s) 153, 211
Bsc4I CCNNNNNNNGG 1 cut(s) 18
Bse1I ACTGG 2 cut(s) 57, 202
BseBI CCWGG 2 cut(s) 41, 212
BseDI CCNNGG 2 cut(s) 153, 211
BseGI GGATG 1 cut(s) 110
BseLI CCNNNNNNNGG 1 cut(s) 18
BseNI ACTGG 2 cut(s) 57, 202
BseXI GCAGC 3 cut(s) 18, 72, 75
BslI CCNNNNNNNGG 1 cut(s) 18
BsmI GAATGC 1 cut(s) 236
Bsp119I TTCGAA 1 cut(s) 168
BspT104I TTCGAA 1 cut(s) 168
BsrI ACTGG 2 cut(s) 57, 202
BssECI CCNNGG 2 cut(s) 153, 211
BssT1I CCWWGG 1 cut(s) 153
Bst2UI CCWGG 2 cut(s) 41, 212
Bst6I CTCTTC 1 cut(s) 115
BstBI TTCGAA 1 cut(s) 168
BstF5I GGATG 1 cut(s) 110
BstMWI GCNNNNNNNGC 1 cut(s) 255
BstNI CCWGG 2 cut(s) 41, 212
BstSCI CCNGG 2 cut(s) 39, 210
BstV1I GCAGC 3 cut(s) 18, 72, 75
BtsCI GGATG 1 cut(s) 110
BtsIMutI CAGTG 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 37
CviJI RGCY 4 cut(s) 31, 85, 99, 258
CviKI_1 RGCY 4 cut(s) 31, 85, 99, 258
Eam1104I CTCTTC 1 cut(s) 115
EarI CTCTTC 1 cut(s) 115
Eco130I CCWWGG 1 cut(s) 153
Eco32I GATATC 1 cut(s) 188
Eco47I GGWCC 1 cut(s) 37
EcoRI GAATTC 2 cut(s) 44, 170
EcoRII CCWGG 2 cut(s) 39, 210
EcoRV GATATC 1 cut(s) 188
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaiI YATR 1 cut(s) 247
Fnu4HI GCNGC 3 cut(s) 32, 86, 89
FokI GGATG 1 cut(s) 97
Fsp4HI GCNGC 3 cut(s) 32, 86, 89
FspBI CTAG 2 cut(s) 80, 154
GluI GCNGC 3 cut(s) 32, 86, 89
HindIII AAGCTT 1 cut(s) 97
HphI GGTGA 1 cut(s) 234
Hpy166II GTNNAC 3 cut(s) 77, 195, 225
Hpy188I TCNGA 2 cut(s) 176, 204
Hpy188III TCNNGA 1 cut(s) 49
Hpy8I GTNNAC 3 cut(s) 77, 195, 225
HpyCH4V TGCA 1 cut(s) 91
HpyF10VI GCNNNNNNNGC 1 cut(s) 255
LmnI GCTCC 1 cut(s) 255
LpnPI CCDG 7 cut(s) 20, 26, 53, 70, 183, 197, 224
Lsp1109I GCAGC 3 cut(s) 18, 72, 75
LweI GCATC 1 cut(s) 167
MaeI CTAG 2 cut(s) 80, 154
MboII GAAGA 1 cut(s) 132
MluCI AATT 3 cut(s) 44, 170, 206
MnlI CCTC 1 cut(s) 116
MroXI GAANNNNTTC 2 cut(s) 7, 100
MseI TTAA 2 cut(s) 68, 232
MspR9I CCNGG 2 cut(s) 41, 212
Mva1269I GAATGC 1 cut(s) 236
MvaI CCWGG 2 cut(s) 41, 212
MwoI GCNNNNNNNGC 1 cut(s) 255
NspV TTCGAA 1 cut(s) 168
PctI GAATGC 1 cut(s) 236
PdmI GAANNNNTTC 2 cut(s) 7, 100
PflMI CCANNNNNTGG 1 cut(s) 18
PfoI TCCNGGA 1 cut(s) 39
PkrI GCNGC 3 cut(s) 33, 87, 90
Psp6I CCWGG 2 cut(s) 39, 210
PspGI CCWGG 2 cut(s) 39, 210
PspPI GGNCC 1 cut(s) 37
SaqAI TTAA 2 cut(s) 68, 232
SatI GCNGC 3 cut(s) 32, 86, 89
Sau96I GGNCC 1 cut(s) 37
ScrFI CCNGG 2 cut(s) 41, 212
SetI ASST 6 cut(s) 9, 101, 127, 224, 230, 260
SfaNI GCATC 1 cut(s) 167
SfuI TTCGAA 1 cut(s) 168
SinI GGWCC 1 cut(s) 37
Sse9I AATT 3 cut(s) 44, 170, 206
SspMI CTAG 2 cut(s) 80, 154
StyD4I CCNGG 2 cut(s) 39, 210
StyI CCWWGG 1 cut(s) 153
TaqI TCGA 1 cut(s) 168
TasI AATT 3 cut(s) 44, 170, 206
Tru1I TTAA 2 cut(s) 68, 232
Tru9I TTAA 2 cut(s) 68, 232
TscAI CASTG 1 cut(s) 64
TseI GCWGC 3 cut(s) 31, 85, 88
TspGWI ACGGA 1 cut(s) 103
TspRI CASTG 1 cut(s) 64
Van91I CCANNNNNTGG 1 cut(s) 18
VpaK11BI GGWCC 1 cut(s) 37
XapI RAATTY 3 cut(s) 44, 170, 206
XcmI CCANNNNNNNNNTGG 1 cut(s) 248
XmaJI CCTAGG 1 cut(s) 153
XmnI GAANNNNTTC 2 cut(s) 7, 100
XspI CTAG 2 cut(s) 80, 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.