Rmu_sc0038532.1_g000001

Pyrophosphatase that hydrolyzes non-canonical purine nucleotides such as inosine triphosphate (ITP), deoxyinosine triphosphate (dITP) or xanthosine 5'-triphosphate (XTP) to their respective monophosphate derivatives. The enzyme does not distinguish between the deoxy- and ribose forms. Probably excludes non-canonical purines from RNA and DNA precursor pools, thus preventing their incorporation into RNA and DNA and avoiding chromosomal lesions

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0038532.1
Physical Location & Seq
Forward (+)
9022 .. 9324
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0038532.1_g000001.1.cds

Sequence Viewer

Length: 213 bp
atgcattttatggatgaatgtcaggggaaaatagttcctgcaaggggaccaaatgattttggatgggatccaatatttcaacctgatggttacgagcaaacttatgccgagatgtcaaaggaagaaaagaacaagatttctcatcgctctagagctcttgcactagtgaagtctcactttgctgaagctgcatacacttttgagaccaactag

Protein Analysis

70

Amino Acids

8.07

Weight (kDa)

5.48

Isoelectric Point (pI)

47.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010856)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 62, 75
AcuI CTGAAG 1 cut(s) 204
AfiI CCNNNNNNNGG 1 cut(s) 44
AgsI TTSAA 1 cut(s) 80
AhlI ACTAGT 1 cut(s) 163
AluBI AGCT 2 cut(s) 155, 188
AluI AGCT 2 cut(s) 155, 188
Alw21I GWGCWC 1 cut(s) 157
Alw26I GTCTC 2 cut(s) 177, 197
AlwI GGATC 2 cut(s) 62, 75
ApeKI GCWGC 1 cut(s) 188
AspS9I GGNCC 1 cut(s) 47
AvaII GGWCC 1 cut(s) 47
BamHI GGATCC 1 cut(s) 67
BanII GRGCYC 1 cut(s) 157
Bbv12I GWGCWC 1 cut(s) 157
BbvI GCAGC 1 cut(s) 175
BccI CCATC 2 cut(s) 57, 80
BcoDI GTCTC 2 cut(s) 177, 197
BcuI ACTAGT 1 cut(s) 163
BfaI CTAG 3 cut(s) 150, 164, 211
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
Bme18I GGWCC 1 cut(s) 47
BmgT120I GGNCC 1 cut(s) 47
BmiI GGNNCC 2 cut(s) 48, 69
BsaI GGTCTC 1 cut(s) 197
Bsc4I CCNNNNNNNGG 1 cut(s) 44
BseGI GGATG 2 cut(s) 19, 68
BseLI CCNNNNNNNGG 1 cut(s) 44
BseXI GCAGC 1 cut(s) 175
BsiHKAI GWGCWC 1 cut(s) 157
BslFI GGGAC 1 cut(s) 60
BslI CCNNNNNNNGG 1 cut(s) 44
BsmAI GTCTC 2 cut(s) 177, 197
BsmFI GGGAC 1 cut(s) 60
Bso31I GGTCTC 1 cut(s) 197
Bsp1286I GDGCHC 1 cut(s) 157
Bsp143I GATC 1 cut(s) 67
BspLI GGNNCC 2 cut(s) 48, 69
BspPI GGATC 2 cut(s) 62, 75
BspTNI GGTCTC 1 cut(s) 197
BssMI GATC 1 cut(s) 67
BstF5I GGATG 2 cut(s) 19, 68
BstKTI GATC 1 cut(s) 70
BstMAI GTCTC 2 cut(s) 177, 197
BstMBI GATC 1 cut(s) 67
BstMWI GCNNNNNNNGC 1 cut(s) 188
BstV1I GCAGC 1 cut(s) 175
BstX2I RGATCY 1 cut(s) 67
BstYI RGATCY 1 cut(s) 67
BtgZI GCGATG 1 cut(s) 128
BtsCI GGATG 2 cut(s) 19, 68
Cfr13I GGNCC 1 cut(s) 47
CviJI RGCY 2 cut(s) 155, 188
CviKI_1 RGCY 2 cut(s) 155, 188
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
Ecl136II GAGCTC 1 cut(s) 155
Eco24I GRGCYC 1 cut(s) 157
Eco31I GGTCTC 1 cut(s) 197
Eco47I GGWCC 1 cut(s) 47
Eco53kI GAGCTC 1 cut(s) 155
Eco57I CTGAAG 1 cut(s) 204
EcoICRI GAGCTC 1 cut(s) 155
EcoT22I ATGCAT 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 157
FaiI YATR 3 cut(s) 11, 105, 193
FalI AAGNNNNNCTT 2 cut(s) 161, 193
FaqI GGGAC 1 cut(s) 60
Fnu4HI GCNGC 1 cut(s) 189
FokI GGATG 2 cut(s) 26, 75
FriOI GRGCYC 1 cut(s) 157
Fsp4HI GCNGC 1 cut(s) 189
FspBI CTAG 3 cut(s) 150, 164, 211
GluI GCNGC 1 cut(s) 189
Hpy188III TCNNGA 1 cut(s) 150
HpyCH4V TGCA 4 cut(s) 4, 41, 161, 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 3 cut(s) 8, 51, 96
Lsp1109I GCAGC 1 cut(s) 175
MaeI CTAG 3 cut(s) 150, 164, 211
MaeIII GTNAC 1 cut(s) 89
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MboII GAAGA 1 cut(s) 134
MflI RGATCY 1 cut(s) 67
MhlI GDGCHC 1 cut(s) 157
Mph1103I ATGCAT 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 188
NdeII GATC 1 cut(s) 67
NlaIV GGNNCC 2 cut(s) 48, 69
NmeAIII GCCGAG 1 cut(s) 133
NsiI ATGCAT 1 cut(s) 6
PkrI GCNGC 1 cut(s) 190
Psp124BI GAGCTC 1 cut(s) 157
PspN4I GGNNCC 2 cut(s) 48, 69
PspPI GGNCC 1 cut(s) 47
PsuI RGATCY 1 cut(s) 67
SacI GAGCTC 1 cut(s) 157
SatI GCNGC 1 cut(s) 189
Sau3AI GATC 1 cut(s) 67
Sau96I GGNCC 1 cut(s) 47
SduI GDGCHC 1 cut(s) 157
SetI ASST 3 cut(s) 85, 157, 190
SinI GGWCC 1 cut(s) 47
SpeI ACTAGT 1 cut(s) 163
SspI AATATT 1 cut(s) 75
SspMI CTAG 3 cut(s) 150, 164, 211
SstI GAGCTC 1 cut(s) 157
TseI GCWGC 1 cut(s) 188
TspDTI ATGAA 1 cut(s) 30
VpaK11BI GGWCC 1 cut(s) 47
XbaI TCTAGA 1 cut(s) 149
XspI CTAG 3 cut(s) 150, 164, 211
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.