Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0039748.1

Orthogroup ID

OG0016466

Physical Location & Seq

Genomic Coordinates Reverse (-)

1635 .. 2830

Gene Structure 1196 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0039748.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 285 bp

atgtacaagcttggtagtcgttgctgctccgggagaccggctcgctactttgccgacgctaagcctgctccggtggttgctttgttttcgggtagaggaccgaacgggttgaacccggaaattctgaagcctgatctgatcgttccgggagtcaacatcctcgctgctaggaccgacgcgctaccggtgaccggaatccggcaaacttggattccggattccgataatccggcggccggtgaccgagctccggcgaagttccttatggtttctctctctaagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Inhibitor_I9 PA Peptidase_S8

Protein Analysis

94

Amino Acids

9.96

Weight (kDa)

9.69

Isoelectric Point (pI)

37.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016466)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000014093 RLG00000017841
rosa_multiflora	Rmu_sc0000299.1_g000004 Rmu_sc0039748.1_g000001 Rmu_sc0040042.1_g000001
rosa_roxburghii	Rroxscaffold_2G00117020
rosa_samantha	Rh3AG032800 Rh3CG031900 Rh3DG032800 Rh4BG338100 Rh4CG353500 Rh5BG141300 Rh5DG474400 Rh6BG150500 Rh7DG249700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	179
AccIII	TCCGGA	1 cut(s)	214
AciI	CCGC	1 cut(s)	233
AcoI	YGGCCR	1 cut(s)	234
AcsI	RAATTY	1 cut(s)	120
AcuI	CTGAAG	1 cut(s)	146
AfaI	GTAC	1 cut(s)	5
AfiI	CCNNNNNNNGG	4 cut(s)	191, 198, 236, 250
AgeI	ACCGGT	1 cut(s)	184
AgsI	TTSAA	1 cut(s)	112
AluBI	AGCT	2 cut(s)	10, 248
AluI	AGCT	2 cut(s)	10, 248
Alw21I	GWGCWC	1 cut(s)	250
Alw26I	GTCTC	1 cut(s)	28
Aor13HI	TCCGGA	1 cut(s)	214
AoxI	GGCC	1 cut(s)	234
ApeKI	GCWGC	2 cut(s)	24, 164
ApoI	RAATTY	1 cut(s)	120
AsiGI	ACCGGT	1 cut(s)	184
AspLEI	GCGC	1 cut(s)	181
AspS9I	GGNCC	2 cut(s)	98, 171
AsuC2I	CCSGG	3 cut(s)	31, 116, 147
AsuHPI	GGTGA	2 cut(s)	199, 251
AvaII	GGWCC	2 cut(s)	98, 171
BanII	GRGCYC	1 cut(s)	250
Bbv12I	GWGCWC	1 cut(s)	250
BbvI	GCAGC	2 cut(s)	11, 151
BcnI	CCSGG	3 cut(s)	31, 116, 147
BcoDI	GTCTC	1 cut(s)	28
BfaI	CTAG	1 cut(s)	168
BisI	GCNGC	3 cut(s)	25, 165, 234
BlpI	GCTNAGC	1 cut(s)	60
BlsI	GCNGC	3 cut(s)	26, 166, 235
Bme1390I	CCNGG	3 cut(s)	31, 116, 147
Bme18I	GGWCC	2 cut(s)	98, 171
BmgT120I	GGNCC	2 cut(s)	98, 171
BmrFI	CCNGG	3 cut(s)	31, 116, 147
BplI	GAGNNNNNCTC	2 cut(s)	25, 57
Bpu1102I	GCTNAGC	1 cut(s)	60
BpuMI	CCSGG	3 cut(s)	31, 116, 147
BsaI	GGTCTC	1 cut(s)	28
BsaWI	WCCGGW	4 cut(s)	70, 184, 191, 214
Bsc4I	CCNNNNNNNGG	4 cut(s)	191, 198, 236, 250
Bse118I	RCCGGY	3 cut(s)	37, 184, 236
BseAI	TCCGGA	1 cut(s)	214
BseGI	GGATG	1 cut(s)	156
BseLI	CCNNNNNNNGG	4 cut(s)	191, 198, 236, 250
BseX3I	CGGCCG	1 cut(s)	234
BseXI	GCAGC	2 cut(s)	11, 151
Bsh1236I	CGCG	1 cut(s)	179
Bsh1285I	CGRYCG	1 cut(s)	237
BshFI	GGCC	1 cut(s)	236
BshTI	ACCGGT	1 cut(s)	184
BsiEI	CGRYCG	1 cut(s)	237
BsiHKAI	GWGCWC	1 cut(s)	250
BslI	CCNNNNNNNGG	4 cut(s)	191, 198, 236, 250
BsmAI	GTCTC	1 cut(s)	28
BsnI	GGCC	1 cut(s)	236
Bso31I	GGTCTC	1 cut(s)	28
Bsp1286I	GDGCHC	1 cut(s)	250
Bsp13I	TCCGGA	1 cut(s)	214
Bsp1407I	TGTACA	1 cut(s)	3
Bsp143I	GATC	2 cut(s)	133, 138
Bsp1720I	GCTNAGC	1 cut(s)	60
BspACI	CCGC	1 cut(s)	233
BspANI	GGCC	1 cut(s)	236
BspEI	TCCGGA	1 cut(s)	214
BspFNI	CGCG	1 cut(s)	179
BspTNI	GGTCTC	1 cut(s)	28
BsrFI	RCCGGY	3 cut(s)	37, 184, 236
BsrGI	TGTACA	1 cut(s)	3
BssAI	RCCGGY	3 cut(s)	37, 184, 236
BssMI	GATC	2 cut(s)	133, 138
BstAUI	TGTACA	1 cut(s)	3
BstC8I	GCNNGC	2 cut(s)	43, 66
BstDEI	CTNAG	2 cut(s)	60, 279
BstEII	GGTNACC	2 cut(s)	187, 239
BstF5I	GGATG	1 cut(s)	156
BstFNI	CGCG	1 cut(s)	179
BstHHI	GCGC	1 cut(s)	181
BstKTI	GATC	2 cut(s)	136, 141
BstMAI	GTCTC	1 cut(s)	28
BstMBI	GATC	2 cut(s)	133, 138
BstMCI	CGRYCG	1 cut(s)	237
BstMWI	GCNNNNNNNGC	1 cut(s)	65
BstPI	GGTNACC	2 cut(s)	187, 239
BstSCI	CCNGG	3 cut(s)	29, 114, 145
BstUI	CGCG	1 cut(s)	179
BstV1I	GCAGC	2 cut(s)	11, 151
BstZI	CGGCCG	1 cut(s)	234
BsuRI	GGCC	1 cut(s)	236
BtsCI	GGATG	1 cut(s)	156
Cac8I	GCNNGC	2 cut(s)	43, 66
CfoI	GCGC	1 cut(s)	181
Cfr10I	RCCGGY	3 cut(s)	37, 184, 236
Cfr13I	GGNCC	2 cut(s)	98, 171
CseI	GACGC	2 cut(s)	65, 185
Csp6I	GTAC	1 cut(s)	4
CspAI	ACCGGT	1 cut(s)	184
CviJI	RGCY	6 cut(s)	10, 41, 64, 130, 236, 248
CviKI_1	RGCY	6 cut(s)	10, 41, 64, 130, 236, 248
CviQI	GTAC	1 cut(s)	4
DdeI	CTNAG	2 cut(s)	60, 279
DpnI	GATC	2 cut(s)	135, 140
DpnII	GATC	2 cut(s)	133, 138
EaeI	YGGCCR	1 cut(s)	234
EagI	CGGCCG	1 cut(s)	234
Ecl136II	GAGCTC	1 cut(s)	248
EclXI	CGGCCG	1 cut(s)	234
Eco24I	GRGCYC	1 cut(s)	250
Eco31I	GGTCTC	1 cut(s)	28
Eco47I	GGWCC	2 cut(s)	98, 171
Eco52I	CGGCCG	1 cut(s)	234
Eco53kI	GAGCTC	1 cut(s)	248
Eco57I	CTGAAG	1 cut(s)	146
Eco91I	GGTNACC	2 cut(s)	187, 239
EcoICRI	GAGCTC	1 cut(s)	248
EcoO65I	GGTNACC	2 cut(s)	187, 239
EcoT38I	GRGCYC	1 cut(s)	250
FaiI	YATR	1 cut(s)	266
Fnu4HI	GCNGC	3 cut(s)	25, 165, 234
FokI	GGATG	1 cut(s)	143
FriOI	GRGCYC	1 cut(s)	250
Fsp4HI	GCNGC	3 cut(s)	25, 165, 234
FspBI	CTAG	1 cut(s)	168
GlaI	GCGC	1 cut(s)	180
GluI	GCNGC	3 cut(s)	25, 165, 234
HaeIII	GGCC	1 cut(s)	236
HgaI	GACGC	2 cut(s)	65, 185
HhaI	GCGC	1 cut(s)	181
Hin6I	GCGC	1 cut(s)	179
HinP1I	GCGC	1 cut(s)	179
HincII	GTYRAC	1 cut(s)	154
HindII	GTYRAC	1 cut(s)	154
HindIII	AAGCTT	1 cut(s)	8
HinfI	GANTC	4 cut(s)	150, 195, 211, 218
HphI	GGTGA	2 cut(s)	199, 251
Hpy166II	GTNNAC	1 cut(s)	154
Hpy188I	TCNGA	3 cut(s)	126, 138, 223
Hpy188III	TCNNGA	1 cut(s)	215
Hpy8I	GTNNAC	1 cut(s)	154
Hpy99I	CGWCG	2 cut(s)	59, 179
HpyF10VI	GCNNNNNNNGC	1 cut(s)	65
HpyF3I	CTNAG	2 cut(s)	60, 279
HspAI	GCGC	1 cut(s)	179
Kpn2I	TCCGGA	1 cut(s)	214
Kzo9I	GATC	2 cut(s)	133, 138
LmnI	GCTCC	3 cut(s)	32, 73, 253
Lsp1109I	GCAGC	2 cut(s)	11, 151
MaeI	CTAG	1 cut(s)	168
MaeIII	GTNAC	2 cut(s)	187, 239
MalI	GATC	2 cut(s)	135, 140
MboI	GATC	2 cut(s)	133, 138
MhlI	GDGCHC	1 cut(s)	250
MluCI	AATT	1 cut(s)	120
MlyI	GAGTC	1 cut(s)	159
MnlI	CCTC	2 cut(s)	89, 170
MroI	TCCGGA	1 cut(s)	214
MspR9I	CCNGG	3 cut(s)	31, 116, 147
MvnI	CGCG	1 cut(s)	179
MwoI	GCNNNNNNNGC	1 cut(s)	65
NciI	CCSGG	3 cut(s)	31, 116, 147
NdeII	GATC	2 cut(s)	133, 138
NmuCI	GTSAC	2 cut(s)	187, 239
PfeI	GAWTC	3 cut(s)	195, 211, 218
PfoI	TCCNGGA	2 cut(s)	29, 145
PinAI	ACCGGT	1 cut(s)	184
PkrI	GCNGC	3 cut(s)	26, 166, 235
PleI	GAGTC	1 cut(s)	158
PpsI	GAGTC	1 cut(s)	158
Psp124BI	GAGCTC	1 cut(s)	250
PspEI	GGTNACC	2 cut(s)	187, 239
PspPI	GGNCC	2 cut(s)	98, 171
RsaI	GTAC	1 cut(s)	5
RsaNI	GTAC	1 cut(s)	4
SacI	GAGCTC	1 cut(s)	250
SatI	GCNGC	3 cut(s)	25, 165, 234
Sau3AI	GATC	2 cut(s)	133, 138
Sau96I	GGNCC	2 cut(s)	98, 171
SchI	GAGTC	1 cut(s)	159
ScrFI	CCNGG	3 cut(s)	31, 116, 147
SduI	GDGCHC	1 cut(s)	250
SetI	ASST	2 cut(s)	12, 250
SinI	GGWCC	2 cut(s)	98, 171
Sse9I	AATT	1 cut(s)	120
SsiI	CCGC	1 cut(s)	233
SspMI	CTAG	1 cut(s)	168
SstI	GAGCTC	1 cut(s)	250
StyD4I	CCNGG	3 cut(s)	29, 114, 145
TaqII	GACCGA	3 cut(s)	115, 188, 258
TasI	AATT	1 cut(s)	120
TatI	WGTACW	1 cut(s)	3
TauI	GCSGC	1 cut(s)	236
TfiI	GAWTC	3 cut(s)	195, 211, 218
TseFI	GTSAC	2 cut(s)	187, 239
TseI	GCWGC	2 cut(s)	24, 164
Tsp45I	GTSAC	2 cut(s)	187, 239
VpaK11BI	GGWCC	2 cut(s)	98, 171
XapI	RAATTY	1 cut(s)	120
XspI	CTAG	1 cut(s)	168

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.