Rmu_ssc0000004.1_g000025

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000004.1
OG0014747
Physical Location & Seq
Forward (+)
98191 .. 99120
930 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000004.1_g000025.1.cds

Sequence Viewer

Length: 930 bp
atggacgacgccgatgacgactactctagtaccgactcatcttccgattccagtactactattccggcaacctccgccggaatcgtcatgctctctctcccggacagtttcgatgaggatgcagccgaggacaagagcagcgccgaccaggacgttttcgagaccccgccggagtcctcgctcgtcggaacctcccaggagaagactcccttgctcgatcttgatcagatcggcgatggcgacgacgacgacgatcgtgatttcgagggagttggagatataggagatgggagcggcgtcatcgtggccgtcggtggttgcggcgaggaaggcgacggtgccgtggatttggggcgggatgctgatctggtggcttcggaggcggaatcggtggaatttagggtttcgaagagggatttgtcgatggaagggagttcggaggagtcttggccgccgtcgaagaaattgagggtttcggagcaggaatcggggaaatcagaggaggaattggagaccgagcggctcagtctgagcaacctcggctctgattccgatcaaactctcgaaattgcaggggatgatgccaaatcagttgaggaaagctcaggaaaaaagaatgctgagcattcagacagcgagagtgagaatgctactgaagagactcaaccagttactgaagaaagcggtagcccatccggcgtggagtattcctatcaggaaggcagtgaaattgattccggagtgcttcgagtgctgcctctatccgtctgcccaccagcagactcgagtgaggggcatagctggtctagtctgttggagatgttgaaacgtgtgagagaaataactcgtcaggactgtaaaaatgaggttgataaatgtagctttttggagatagctaagcgtcgcggcatgactttccctcagctgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

309

Amino Acids

32.99

Weight (kDa)

4.05

Isoelectric Point (pI)

57.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 338
AccBSI CCGCTC 2 cut(s) 294, 520
AccII CGCG 1 cut(s) 906
AccIII TCCGGA 1 cut(s) 737
AcoI YGGCCR 2 cut(s) 306, 449
AcsI RAATTY 1 cut(s) 395
AcuI CTGAAG 2 cut(s) 675, 696
AcyI GRCGYC 2 cut(s) 9, 297
AfaI GTAC 2 cut(s) 31, 55
AflIII ACRYGT 1 cut(s) 829
AgsI TTSAA 1 cut(s) 826
AjnI CCWGG 2 cut(s) 147, 195
AluBI AGCT 5 cut(s) 603, 801, 882, 896, 925
AluI AGCT 5 cut(s) 603, 801, 882, 896, 925
Alw26I GTCTC 3 cut(s) 155, 506, 653
AlwNI CAGNNNCTG 1 cut(s) 674
Ama87I CYCGRG 1 cut(s) 784
Aor13HI TCCGGA 1 cut(s) 737
AoxI GGCC 2 cut(s) 306, 449
ApeKI GCWGC 3 cut(s) 122, 138, 754
ApoI RAATTY 1 cut(s) 395
AspLEI GCGC 1 cut(s) 143
AsuC2I CCSGG 1 cut(s) 101
AsuII TTCGAA 1 cut(s) 407
AvaI CYCGRG 1 cut(s) 784
BaeI ACNNNNGTAYC 2 cut(s) 13, 46
BanI GGYRCC 1 cut(s) 338
BbsI GAAGAC 1 cut(s) 209
BbvCI CCTCAGC 1 cut(s) 921
BbvI GCAGC 3 cut(s) 134, 150, 741
BccI CCATC 4 cut(s) 230, 281, 418, 700
BceAI ACGGC 3 cut(s) 293, 326, 439
BcgI CGANNNNNNTGC 2 cut(s) 101, 135
BciT130I CCWGG 2 cut(s) 149, 197
BclI TGATCA 1 cut(s) 223
BcnI CCSGG 1 cut(s) 101
BcoDI GTCTC 3 cut(s) 155, 506, 653
BfaI CTAG 2 cut(s) 27, 807
BfmI CTRYAG 1 cut(s) 926
BfoI RGCGCY 1 cut(s) 144
BglI GCCNNNNNGGC 1 cut(s) 696
BisI GCNGC 8 cut(s) 123, 139, 295, 322, 452, 521, 755, 907
BlpI GCTNAGC 2 cut(s) 621, 897
BlsI GCNGC 8 cut(s) 124, 140, 296, 323, 453, 522, 756, 908
BmcAI AGTACT 1 cut(s) 55
Bme1390I CCNGG 3 cut(s) 101, 149, 197
BmeT110I CYCGRG 1 cut(s) 784
BmiI GGNNCC 2 cut(s) 190, 340
BmrFI CCNGG 3 cut(s) 101, 149, 197
BmsI GCATC 3 cut(s) 109, 349, 571
BpiI GAAGAC 1 cut(s) 209
BplI GAGNNNNNCTC 2 cut(s) 587, 619
Bpu10I CCTNAGC 2 cut(s) 604, 921
Bpu1102I GCTNAGC 2 cut(s) 621, 897
Bpu14I TTCGAA 1 cut(s) 407
BpuMI CCSGG 1 cut(s) 101
BsaBI GATNNNNATC 3 cut(s) 222, 363, 552
BsaHI GRCGYC 2 cut(s) 9, 297
BsaI GGTCTC 2 cut(s) 155, 506
BsaJI CCNNGG 4 cut(s) 126, 195, 342, 538
BsaWI WCCGGW 1 cut(s) 737
Bse1I ACTGG 2 cut(s) 51, 668
Bse8I GATNNNNATC 3 cut(s) 222, 363, 552
BseAI TCCGGA 1 cut(s) 737
BseBI CCWGG 2 cut(s) 149, 197
BseDI CCNNGG 4 cut(s) 126, 195, 342, 538
BseGI GGATG 4 cut(s) 124, 364, 583, 692
BseJI GATNNNNATC 3 cut(s) 222, 363, 552
BseMII CTCAG 4 cut(s) 521, 538, 612, 618
BseNI ACTGG 2 cut(s) 51, 668
BseRI GAGGAG 2 cut(s) 455, 515
BseXI GCAGC 3 cut(s) 134, 150, 741
Bsh1236I CGCG 1 cut(s) 906
Bsh1285I CGRYCG 1 cut(s) 256
BshFI GGCC 2 cut(s) 308, 451
BshNI GGYRCC 1 cut(s) 338
BsiEI CGRYCG 1 cut(s) 256
BsiHKCI CYCGRG 1 cut(s) 784
BsiSI CCGG 6 cut(s) 65, 78, 101, 170, 696, 738
BsmAI GTCTC 3 cut(s) 155, 506, 653
BsmI GAATGC 3 cut(s) 622, 625, 652
BsnI GGCC 2 cut(s) 308, 451
Bso31I GGTCTC 2 cut(s) 155, 506
BsoBI CYCGRG 1 cut(s) 784
Bsp119I TTCGAA 1 cut(s) 407
Bsp13I TCCGGA 1 cut(s) 737
Bsp143I GATC 6 cut(s) 217, 223, 228, 253, 364, 553
Bsp1720I GCTNAGC 2 cut(s) 621, 897
BspANI GGCC 2 cut(s) 308, 451
BspCNI CTCAG 4 cut(s) 522, 537, 613, 617
BspEI TCCGGA 1 cut(s) 737
BspFNI CGCG 1 cut(s) 906
BspLI GGNNCC 2 cut(s) 190, 340
BspT104I TTCGAA 1 cut(s) 407
BspT107I GGYRCC 1 cut(s) 338
BspTNI GGTCTC 2 cut(s) 155, 506
BsrBI CCGCTC 2 cut(s) 294, 520
BsrI ACTGG 2 cut(s) 51, 668
BssECI CCNNGG 4 cut(s) 126, 195, 342, 538
BssMI GATC 6 cut(s) 217, 223, 228, 253, 364, 553
BssNI GRCGYC 2 cut(s) 9, 297
Bst2UI CCWGG 2 cut(s) 149, 197
Bst4CI ACNGT 3 cut(s) 107, 338, 857
Bst6I CTCTTC 2 cut(s) 404, 651
BstACI GRCGYC 2 cut(s) 9, 297
BstBI TTCGAA 1 cut(s) 407
BstDEI CTNAG 6 cut(s) 524, 530, 604, 621, 897, 921
BstDSI CCRYGG 1 cut(s) 342
BstF5I GGATG 4 cut(s) 124, 364, 583, 692
BstFNI CGCG 1 cut(s) 906
BstH2I RGCGCY 1 cut(s) 144
BstHHI GCGC 1 cut(s) 143
BstKTI GATC 6 cut(s) 220, 226, 231, 256, 367, 556
BstMAI GTCTC 3 cut(s) 155, 506, 653
BstMBI GATC 6 cut(s) 217, 223, 228, 253, 364, 553
BstMCI CGRYCG 1 cut(s) 256
BstMWI GCNNNNNNNGC 6 cut(s) 74, 330, 380, 540, 696, 751
BstNI CCWGG 2 cut(s) 149, 197
BstSCI CCNGG 3 cut(s) 99, 147, 195
BstSFI CTRYAG 1 cut(s) 926
BstUI CGCG 1 cut(s) 906
BstV1I GCAGC 3 cut(s) 134, 150, 741
BstV2I GAAGAC 1 cut(s) 209
BsuRI GGCC 2 cut(s) 308, 451
BtgI CCRYGG 1 cut(s) 342
BtgZI GCGATG 1 cut(s) 249
BtsCI GGATG 4 cut(s) 124, 364, 583, 692
BtsI GCAGTG 1 cut(s) 730
BtsIMutI CAGTG 1 cut(s) 730
CaiI CAGNNNCTG 1 cut(s) 674
CfoI GCGC 1 cut(s) 143
CseI GACGC 3 cut(s) 17, 286, 890
Csp6I GTAC 2 cut(s) 30, 54
CviAII CATG 2 cut(s) 88, 910
CviQI GTAC 2 cut(s) 30, 54
DdeI CTNAG 6 cut(s) 524, 530, 604, 621, 897, 921
DpnI GATC 6 cut(s) 219, 225, 230, 255, 366, 555
DpnII GATC 6 cut(s) 217, 223, 228, 253, 364, 553
EaeI YGGCCR 2 cut(s) 306, 449
Eam1104I CTCTTC 2 cut(s) 404, 651
EarI CTCTTC 2 cut(s) 404, 651
EciI GGCGGA 2 cut(s) 64, 398
Eco31I GGTCTC 2 cut(s) 155, 506
Eco57I CTGAAG 2 cut(s) 675, 696
Eco88I CYCGRG 1 cut(s) 784
EcoRII CCWGG 2 cut(s) 147, 195
FaeI CATG 2 cut(s) 91, 913
FaiI YATR 4 cut(s) 89, 281, 798, 911
FalI AAGNNNNNCTT 2 cut(s) 194, 226
FatI CATG 2 cut(s) 87, 909
FauI CCCGC 2 cut(s) 174, 348
FbaI TGATCA 1 cut(s) 223
Fnu4HI GCNGC 8 cut(s) 123, 139, 295, 322, 452, 521, 755, 907
FokI GGATG 4 cut(s) 131, 371, 590, 679
Fsp4HI GCNGC 8 cut(s) 123, 139, 295, 322, 452, 521, 755, 907
FspBI CTAG 2 cut(s) 27, 807
GlaI GCGC 1 cut(s) 142
GluI GCNGC 8 cut(s) 123, 139, 295, 322, 452, 521, 755, 907
HaeII RGCGCY 1 cut(s) 144
HaeIII GGCC 2 cut(s) 308, 451
HapII CCGG 6 cut(s) 65, 78, 101, 170, 696, 738
HgaI GACGC 3 cut(s) 17, 286, 890
HhaI GCGC 1 cut(s) 143
Hin1I GRCGYC 2 cut(s) 9, 297
Hin1II CATG 2 cut(s) 91, 913
Hin6I GCGC 1 cut(s) 141
HinP1I GCGC 1 cut(s) 141
HpaII CCGG 6 cut(s) 65, 78, 101, 170, 696, 738
Hpy188III TCNNGA 8 cut(s) 160, 221, 257, 563, 606, 716, 738, 851
HpyAV CCTTC 3 cut(s) 323, 422, 713
HpyCH4III ACNGT 3 cut(s) 107, 338, 857
HpyCH4IV ACGT 2 cut(s) 153, 829
HpyCH4V TGCA 2 cut(s) 122, 572
HpyF10VI GCNNNNNNNGC 6 cut(s) 74, 330, 380, 540, 696, 751
HpyF3I CTNAG 6 cut(s) 524, 530, 604, 621, 897, 921
HpySE526I ACGT 2 cut(s) 153, 829
Hsp92I GRCGYC 2 cut(s) 9, 297
Hsp92II CATG 2 cut(s) 91, 913
HspAI GCGC 1 cut(s) 141
Kpn2I TCCGGA 1 cut(s) 737
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 6 cut(s) 217, 223, 228, 253, 364, 553
LmnI GCTCC 2 cut(s) 291, 478
Lsp1109I GCAGC 3 cut(s) 134, 150, 741
LweI GCATC 3 cut(s) 109, 349, 571
MaeI CTAG 2 cut(s) 27, 807
MaeII ACGT 2 cut(s) 153, 829
MaeIII GTNAC 1 cut(s) 670
MalI GATC 6 cut(s) 219, 225, 230, 255, 366, 555
MbiI CCGCTC 2 cut(s) 294, 520
MboI GATC 6 cut(s) 217, 223, 228, 253, 364, 553
MboII GAAGA 6 cut(s) 33, 214, 421, 472, 668, 689
MluCI AATT 5 cut(s) 395, 464, 506, 567, 729
MlyI GAGTC 6 cut(s) 29, 182, 199, 452, 655, 776
MmeI TCCRAC 3 cut(s) 166, 253, 795
MroI TCCGGA 1 cut(s) 737
MspA1I CMGCKG 1 cut(s) 925
MspI CCGG 6 cut(s) 65, 78, 101, 170, 696, 738
MspR9I CCNGG 3 cut(s) 101, 149, 197
Mva1269I GAATGC 3 cut(s) 622, 625, 652
MvaI CCWGG 2 cut(s) 149, 197
MvnI CGCG 1 cut(s) 906
MwoI GCNNNNNNNGC 6 cut(s) 74, 330, 380, 540, 696, 751
NciI CCSGG 1 cut(s) 101
NdeII GATC 6 cut(s) 217, 223, 228, 253, 364, 553
NlaIII CATG 2 cut(s) 91, 913
NlaIV GGNNCC 2 cut(s) 190, 340
NmeAIII GCCGAG 2 cut(s) 151, 519
NspV TTCGAA 1 cut(s) 407
PaeR7I CTCGAG 1 cut(s) 784
PcsI WCGNNNNNNNCGW 3 cut(s) 15, 237, 249
PctI GAATGC 3 cut(s) 622, 625, 652
PfeI GAWTC 6 cut(s) 47, 81, 386, 485, 548, 734
PfoI TCCNGGA 1 cut(s) 99
PkrI GCNGC 8 cut(s) 124, 140, 296, 323, 453, 522, 756, 908
Ple19I CGATCG 1 cut(s) 256
PleI GAGTC 6 cut(s) 29, 181, 199, 451, 655, 776
PpsI GAGTC 6 cut(s) 29, 181, 199, 451, 655, 776
Psp6I CCWGG 2 cut(s) 147, 195
PspGI CCWGG 2 cut(s) 147, 195
PspN4I GGNNCC 2 cut(s) 190, 340
PspXI VCTCGAGB 1 cut(s) 784
PstNI CAGNNNCTG 1 cut(s) 674
PvuI CGATCG 1 cut(s) 256
PvuII CAGCTG 1 cut(s) 925
RsaI GTAC 2 cut(s) 31, 55
RsaNI GTAC 2 cut(s) 30, 54
SatI GCNGC 8 cut(s) 123, 139, 295, 322, 452, 521, 755, 907
Sau3AI GATC 6 cut(s) 217, 223, 228, 253, 364, 553
ScaI AGTACT 1 cut(s) 55
SchI GAGTC 6 cut(s) 29, 182, 199, 452, 655, 776
ScrFI CCNGG 3 cut(s) 101, 149, 197
SfaNI GCATC 3 cut(s) 109, 349, 571
SfcI CTRYAG 1 cut(s) 926
Sfr274I CTCGAG 1 cut(s) 784
SfuI TTCGAA 1 cut(s) 407
SlaI CTCGAG 1 cut(s) 784
SmlI CTYRAG 1 cut(s) 784
SmoI CTYRAG 1 cut(s) 784
Sse9I AATT 5 cut(s) 395, 464, 506, 567, 729
SspMI CTAG 2 cut(s) 27, 807
StyD4I CCNGG 3 cut(s) 99, 147, 195
TaaI ACNGT 3 cut(s) 107, 338, 857
TaiI ACGT 2 cut(s) 156, 832
TaqII GACCGA 1 cut(s) 530
TasI AATT 5 cut(s) 395, 464, 506, 567, 729
TatI WGTACW 1 cut(s) 53
TauI GCSGC 5 cut(s) 297, 324, 454, 523, 909
TfiI GAWTC 6 cut(s) 47, 81, 386, 485, 548, 734
TscAI CASTG 1 cut(s) 730
TseI GCWGC 3 cut(s) 122, 138, 754
TspGWI ACGGA 1 cut(s) 754
TspRI CASTG 1 cut(s) 730
XapI RAATTY 1 cut(s) 395
XhoI CTCGAG 1 cut(s) 784
XspI CTAG 2 cut(s) 27, 807
ZrmI AGTACT 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.