Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000116.1

Orthogroup ID

OG0011173

Physical Location & Seq

Genomic Coordinates Forward (+)

319270 .. 320158

Gene Structure 889 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000116.1_g000061.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 642 bp

atggctgaaacagaaacaaggaagaggaagatgggagagagaagagaagctgattccaattccaggacagcaacaccaaagtggccaacaatcaaaccaaaacaaaacattcagataacccgtctcaaagacaatgatcttttcaccgtacataatttcttcacatgtgcagaatcaaaggcttttgttaaggttgcagagtctattgggtttgttcaccaaggaagtcttggcccaacaaaaggtgaagcttttagagacaatgatagaatctctgtgaacgatcctattcttgctgattctatatggaattctgggctcagcaaattgttttctgacatcaaaattcgaagggaggttgctgttggcttaaacccaaatatcagattctacaggtacaaggttggtcagcgatttgggaggcatattgatgaaagtgttgatcttgaagatggaaaacgcacgcattatactttgttgatatatttgagtggcggtttcaaaccgaaagcgaaaaatgatgtgagcagtcatcaggattcatcctcagagcctctggttggaggagagactgtcttttatggctcaaggaatagtgttgtggctgaggtagtaggctctcttttagtcataccatgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

2OG-FeII_Oxy_3

Protein Analysis

213

Amino Acids

23.86

Weight (kDa)

9.32

Isoelectric Point (pI)

39.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011173)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G51880
fragaria_vesca	FvH4_7g28750 FvH4_7g28750
malus_domestica	MD01G1193900.v1.1
prunus_persica	Prupe.2G287700_v2.0.a1
pyrus_communis	pycom01g20420
rosa_chinensis	RchiOBHm_Chr1g0376301
rosa_laevigata	RLG00000026613
rosa_multiflora	Rmu_ssc0000116.1_g000061
rosa_roxburghii	Rroxscaffold_4G00282220
rosa_rugosa	Rorug01G0395100 Rorug01G0395200 Rorug01G0395300 Rorug01G0395300 Rorug01G0395400
rosa_samantha	Rh1AG406500 Rh1BG370500 Rh1CG383300 Rh1DG400300
rosa_wichuraiana	Rw1G036080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	495
AclWI	GGATC	1 cut(s)	278
AcoI	YGGCCR	1 cut(s)	83
AcsI	RAATTY	2 cut(s)	310, 345
AfaI	GTAC	2 cut(s)	150, 398
AfiI	CCNNNNNNNGG	3 cut(s)	63, 242, 560
AflIII	ACRYGT	1 cut(s)	164
AgsI	TTSAA	2 cut(s)	449, 502
AjnI	CCWGG	1 cut(s)	62
AleI	CACNNNNGTG	1 cut(s)	79
AluBI	AGCT	2 cut(s)	50, 251
AluI	AGCT	2 cut(s)	50, 251
Alw26I	GTCTC	3 cut(s)	128, 252, 563
AlwI	GGATC	1 cut(s)	278
AoxI	GGCC	2 cut(s)	83, 232
ApoI	RAATTY	2 cut(s)	310, 345
AspS9I	GGNCC	1 cut(s)	233
AsuHPI	GGTGA	3 cut(s)	136, 209, 257
AsuII	TTCGAA	1 cut(s)	349
BalI	TGGCCA	1 cut(s)	85
BanII	GRGCYC	1 cut(s)	321
BbvCI	CCTCAGC	1 cut(s)	606
BccI	CCATC	2 cut(s)	25, 446
BciT130I	CCWGG	1 cut(s)	64
BcoDI	GTCTC	3 cut(s)	128, 252, 563
BfmI	CTRYAG	1 cut(s)	391
BlpI	GCTNAGC	1 cut(s)	320
Bme1390I	CCNGG	1 cut(s)	64
BmgT120I	GGNCC	1 cut(s)	233
BmrFI	CCNGG	1 cut(s)	64
Bpu10I	CCTNAGC	1 cut(s)	606
Bpu1102I	GCTNAGC	1 cut(s)	320
Bpu14I	TTCGAA	1 cut(s)	349
BpuEI	CTTGAG	1 cut(s)	571
BsaJI	CCNNGG	1 cut(s)	220
BsaXI	ACNNNNNCTCC	2 cut(s)	558, 588
Bsc4I	CCNNNNNNNGG	3 cut(s)	63, 242, 560
BseBI	CCWGG	1 cut(s)	64
BseDI	CCNNGG	1 cut(s)	220
BseGI	GGATG	1 cut(s)	542
BseLI	CCNNNNNNNGG	3 cut(s)	63, 242, 560
BseMII	CTCAG	3 cut(s)	334, 561, 597
BseRI	GAGGAG	1 cut(s)	579
BsgI	GTGCAG	1 cut(s)	189
BshFI	GGCC	2 cut(s)	85, 234
BslI	CCNNNNNNNGG	3 cut(s)	63, 242, 560
BsmAI	GTCTC	3 cut(s)	128, 252, 563
BsmBI	CGTCTC	1 cut(s)	128
BsnI	GGCC	2 cut(s)	85, 234
Bsp119I	TTCGAA	1 cut(s)	349
Bsp1286I	GDGCHC	1 cut(s)	321
Bsp143I	GATC	3 cut(s)	136, 283, 442
Bsp1720I	GCTNAGC	1 cut(s)	320
BspACI	CCGC	1 cut(s)	495
BspANI	GGCC	2 cut(s)	85, 234
BspCNI	CTCAG	3 cut(s)	333, 560, 598
BspPI	GGATC	1 cut(s)	278
BspT104I	TTCGAA	1 cut(s)	349
BssECI	CCNNGG	1 cut(s)	220
BssMI	GATC	3 cut(s)	136, 283, 442
BssT1I	CCWWGG	1 cut(s)	220
Bst2UI	CCWGG	1 cut(s)	64
Bst4CI	ACNGT	2 cut(s)	148, 574
Bst6I	CTCTTC	2 cut(s)	17, 37
BstBI	TTCGAA	1 cut(s)	349
BstC8I	GCNNGC	1 cut(s)	464
BstDEI	CTNAG	3 cut(s)	320, 547, 606
BstF5I	GGATG	1 cut(s)	542
BstKTI	GATC	3 cut(s)	139, 286, 445
BstMAI	GTCTC	3 cut(s)	128, 252, 563
BstMBI	GATC	3 cut(s)	136, 283, 442
BstNI	CCWGG	1 cut(s)	64
BstNSI	RCATGY	1 cut(s)	168
BstSCI	CCNGG	1 cut(s)	62
BstSFI	CTRYAG	1 cut(s)	391
BsuRI	GGCC	2 cut(s)	85, 234
BtsCI	GGATG	1 cut(s)	542
Cac8I	GCNNGC	1 cut(s)	464
Cfr13I	GGNCC	1 cut(s)	233
Csp6I	GTAC	2 cut(s)	149, 397
CviAII	CATG	2 cut(s)	165, 636
CviQI	GTAC	2 cut(s)	149, 397
DdeI	CTNAG	3 cut(s)	320, 547, 606
DpnI	GATC	3 cut(s)	138, 285, 444
DpnII	GATC	3 cut(s)	136, 283, 442
EaeI	YGGCCR	1 cut(s)	83
Eam1104I	CTCTTC	2 cut(s)	17, 37
EarI	CTCTTC	2 cut(s)	17, 37
Eco130I	CCWWGG	1 cut(s)	220
Eco24I	GRGCYC	1 cut(s)	321
EcoRI	GAATTC	1 cut(s)	310
EcoRII	CCWGG	1 cut(s)	62
EcoT14I	CCWWGG	1 cut(s)	220
EcoT38I	GRGCYC	1 cut(s)	321
ErhI	CCWWGG	1 cut(s)	220
Esp3I	CGTCTC	1 cut(s)	128
FaeI	CATG	2 cut(s)	168, 639
FalI	AAGNNNNNCTT	2 cut(s)	213, 245
FatI	CATG	2 cut(s)	164, 635
FokI	GGATG	1 cut(s)	529
FriOI	GRGCYC	1 cut(s)	321
HaeIII	GGCC	2 cut(s)	85, 234
Hin1II	CATG	2 cut(s)	168, 639
HindIII	AAGCTT	1 cut(s)	249
HinfI	GANTC	7 cut(s)	53, 173, 200, 270, 299, 387, 539
HphI	GGTGA	3 cut(s)	136, 209, 257
Hpy166II	GTNNAC	2 cut(s)	217, 280
Hpy188I	TCNGA	4 cut(s)	114, 337, 386, 550
Hpy188III	TCNNGA	2 cut(s)	446, 536
Hpy8I	GTNNAC	2 cut(s)	217, 280
HpyAV	CCTTC	1 cut(s)	345
HpyCH4III	ACNGT	2 cut(s)	148, 574
HpyCH4V	TGCA	2 cut(s)	170, 197
HpyF3I	CTNAG	3 cut(s)	320, 547, 606
Hsp92II	CATG	2 cut(s)	168, 639
Kzo9I	GATC	3 cut(s)	136, 283, 442
LpnPI	CCDG	6 cut(s)	49, 76, 300, 379, 521, 542
MalI	GATC	3 cut(s)	138, 285, 444
MboI	GATC	3 cut(s)	136, 283, 442
MboII	GAAGA	5 cut(s)	34, 40, 54, 151, 461
MhlI	GDGCHC	1 cut(s)	321
MlsI	TGGCCA	1 cut(s)	85
MluCI	AATT	5 cut(s)	58, 154, 310, 326, 345
MluNI	TGGCCA	1 cut(s)	85
MlyI	GAGTC	1 cut(s)	209
MmeI	TCCRAC	1 cut(s)	541
MnlI	CCTC	7 cut(s)	18, 349, 414, 556, 557, 564, 601
Mox20I	TGGCCA	1 cut(s)	85
MscI	TGGCCA	1 cut(s)	85
MseI	TTAA	2 cut(s)	189, 371
MslI	CAYNNNNRTG	2 cut(s)	79, 429
Msp20I	TGGCCA	1 cut(s)	85
MspR9I	CCNGG	1 cut(s)	64
MvaI	CCWGG	1 cut(s)	64
NdeII	GATC	3 cut(s)	136, 283, 442
NlaIII	CATG	2 cut(s)	168, 639
NspI	RCATGY	1 cut(s)	168
NspV	TTCGAA	1 cut(s)	349
OliI	CACNNNNGTG	1 cut(s)	79
PciI	ACATGT	1 cut(s)	164
PfeI	GAWTC	6 cut(s)	53, 173, 270, 299, 387, 539
PfoI	TCCNGGA	1 cut(s)	62
PleI	GAGTC	1 cut(s)	208
PpsI	GAGTC	1 cut(s)	208
PscI	ACATGT	1 cut(s)	164
Psp6I	CCWGG	1 cut(s)	62
PspGI	CCWGG	1 cut(s)	62
PspPI	GGNCC	1 cut(s)	233
RsaI	GTAC	2 cut(s)	150, 398
RsaNI	GTAC	2 cut(s)	149, 397
RseI	CAYNNNNRTG	2 cut(s)	79, 429
SaqAI	TTAA	2 cut(s)	189, 371
Sau3AI	GATC	3 cut(s)	136, 283, 442
Sau96I	GGNCC	1 cut(s)	233
SchI	GAGTC	1 cut(s)	209
ScrFI	CCNGG	1 cut(s)	64
SduI	GDGCHC	1 cut(s)	321
SetI	ASST	8 cut(s)	52, 195, 247, 253, 360, 398, 405, 612
SfcI	CTRYAG	1 cut(s)	391
SfuI	TTCGAA	1 cut(s)	349
SmiMI	CAYNNNNRTG	2 cut(s)	79, 429
SmlI	CTYRAG	1 cut(s)	586
SmoI	CTYRAG	1 cut(s)	586
Sse9I	AATT	5 cut(s)	58, 154, 310, 326, 345
SsiI	CCGC	1 cut(s)	495
StyD4I	CCNGG	1 cut(s)	62
StyI	CCWWGG	1 cut(s)	220
TaaI	ACNGT	2 cut(s)	148, 574
TaqI	TCGA	1 cut(s)	349
TasI	AATT	5 cut(s)	58, 154, 310, 326, 345
TfiI	GAWTC	6 cut(s)	53, 173, 270, 299, 387, 539
Tru1I	TTAA	2 cut(s)	189, 371
Tru9I	TTAA	2 cut(s)	189, 371
TspDTI	ATGAA	2 cut(s)	447, 531
XapI	RAATTY	2 cut(s)	310, 345
XceI	RCATGY	1 cut(s)	168
XcmI	CCANNNNNNNNNTGG	1 cut(s)	227

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.