Rmu_ssc0000154.1_g000014

E3 ubiquitin ligase BIG

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000154.1
Physical Location & Seq
Forward (+)
83912 .. 87231
3320 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000154.1_g000014.1.cds

Sequence Viewer

Length: 738 bp
atgaacgggaatggacaaatggaggtgcattacatagacaccggcttcccttacacggctactgaaagctttatggacttctttgaaggtcttactcatgcccccgtgacctatggtcacgccatgcccgtgcatgatcaggaagctgcatactggtcaatgaatatgcactcctacaaatttggactctctggtccggggaatacgtcttattatggtccttatgaggtaaatactcattttccgagaatggatatgagcaggagggcttgggaatatcctttaatgacaaattcagaagagcctgctacaactgcttcgcaaccagaagaaactgtagtcgaggaagttgatgtcataaccgaagaatccattccaaatgagcaaaacacaaatacttctcaggcggaatgggaagagaacatcgatcctgataacatgacatatgaggaattactcgatttgggtgaggctgttggtactcaaagccgagggctttccgacgaacttattagcttgcttcccacaaccaaatacaagtgtggaagctttttctcaagaaagaaatctggagagagatgtgtaatttgccaggcgaggtacaaaagaggagctcgacaaatgaaattgccctgcaatcatttttaccatagcgaatgcatcagcaaatggctcggcatcaacaagatatgcccagtctgcaaccttgaggtattcgccgaggaatcaaggcattaa

Protein Analysis

245

Amino Acids

27.96

Weight (kDa)

4.87

Isoelectric Point (pI)

47.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 192
AciI CCGC 1 cut(s) 407
AclWI GGATC 1 cut(s) 422
AcsI RAATTY 2 cut(s) 179, 292
AfaI GTAC 2 cut(s) 481, 602
AfiI CCNNNNNNNGG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 86
AhdI GACNNNNNGTC 1 cut(s) 114
AjnI CCWGG 1 cut(s) 591
AluBI AGCT 5 cut(s) 69, 146, 516, 549, 614
AluI AGCT 5 cut(s) 69, 146, 516, 549, 614
Alw21I GWGCWC 1 cut(s) 616
AlwI GGATC 1 cut(s) 422
ApeKI GCWGC 1 cut(s) 146
ApoI RAATTY 2 cut(s) 179, 292
Asp700I GAANNNNTTC 1 cut(s) 372
AspS9I GGNCC 2 cut(s) 194, 218
AsuC2I CCSGG 1 cut(s) 198
AsuHPI GGTGA 1 cut(s) 479
AvaII GGWCC 2 cut(s) 194, 218
BanII GRGCYC 1 cut(s) 616
Bbv12I GWGCWC 1 cut(s) 616
BbvI GCAGC 1 cut(s) 133
BceAI ACGGC 1 cut(s) 72
BcgI CGANNNNNNTGC 2 cut(s) 655, 689
BciT130I CCWGG 1 cut(s) 593
BclI TGATCA 1 cut(s) 136
BcnI CCSGG 1 cut(s) 198
BfmI CTRYAG 1 cut(s) 336
BisI GCNGC 1 cut(s) 147
BlsI GCNGC 1 cut(s) 148
Bme1390I CCNGG 2 cut(s) 198, 593
Bme18I GGWCC 2 cut(s) 194, 218
BmeRI GACNNNNNGTC 1 cut(s) 114
BmgT120I GGNCC 2 cut(s) 194, 218
BmrFI CCNGG 2 cut(s) 198, 593
BmrI ACTGGG 1 cut(s) 689
BmsI GCATC 2 cut(s) 669, 687
BmuI ACTGGG 1 cut(s) 689
BpmI CTGGAG 1 cut(s) 591
BpuEI CTTGAG 2 cut(s) 541, 728
BpuMI CCSGG 1 cut(s) 198
Bsa29I ATCGAT 1 cut(s) 426
BsaJI CCNNGG 3 cut(s) 197, 490, 720
Bsc4I CCNNNNNNNGG 1 cut(s) 55
Bse118I RCCGGY 1 cut(s) 41
Bse1I ACTGG 2 cut(s) 158, 695
BseBI CCWGG 1 cut(s) 593
BseCI ATCGAT 1 cut(s) 426
BseDI CCNNGG 3 cut(s) 197, 490, 720
BseLI CCNNNNNNNGG 1 cut(s) 55
BseMII CTCAG 1 cut(s) 416
BseNI ACTGG 2 cut(s) 158, 695
BseRI GAGGAG 1 cut(s) 624
BseXI GCAGC 1 cut(s) 133
BshVI ATCGAT 1 cut(s) 426
BsiHKAI GWGCWC 1 cut(s) 616
BsiSI CCGG 2 cut(s) 42, 197
BslI CCNNNNNNNGG 1 cut(s) 55
BsmI GAATGC 1 cut(s) 662
Bsp1286I GDGCHC 1 cut(s) 616
Bsp143I GATC 2 cut(s) 136, 427
BspACI CCGC 1 cut(s) 407
BspCNI CTCAG 1 cut(s) 415
BspDI ATCGAT 1 cut(s) 426
BspPI GGATC 1 cut(s) 422
BspQI GCTCTTC 1 cut(s) 294
BsrFI RCCGGY 1 cut(s) 41
BsrI ACTGG 2 cut(s) 158, 695
BssAI RCCGGY 1 cut(s) 41
BssECI CCNNGG 3 cut(s) 197, 490, 720
BssMI GATC 2 cut(s) 136, 427
Bst2UI CCWGG 1 cut(s) 593
Bst4CI ACNGT 1 cut(s) 337
Bst6I CTCTTC 2 cut(s) 294, 411
BstC8I GCNNGC 2 cut(s) 306, 518
BstDEI CTNAG 1 cut(s) 402
BstKTI GATC 2 cut(s) 139, 430
BstMBI GATC 2 cut(s) 136, 427
BstMWI GCNNNNNNNGC 2 cut(s) 314, 699
BstNI CCWGG 1 cut(s) 593
BstSCI CCNGG 2 cut(s) 196, 591
BstSFI CTRYAG 1 cut(s) 336
BstV1I GCAGC 1 cut(s) 133
Bsu15I ATCGAT 1 cut(s) 426
BsuTUI ATCGAT 1 cut(s) 426
Cac8I GCNNGC 2 cut(s) 306, 518
Cfr10I RCCGGY 1 cut(s) 41
Cfr13I GGNCC 2 cut(s) 194, 218
ClaI ATCGAT 1 cut(s) 426
Csp6I GTAC 2 cut(s) 480, 601
CviAII CATG 4 cut(s) 98, 124, 134, 439
CviQI GTAC 2 cut(s) 480, 601
DdeI CTNAG 1 cut(s) 402
DpnI GATC 2 cut(s) 138, 429
DpnII GATC 2 cut(s) 136, 427
DrdI GACNNNNNNGTC 1 cut(s) 192
DriI GACNNNNNGTC 1 cut(s) 114
DseDI GACNNNNNNGTC 1 cut(s) 192
Eam1104I CTCTTC 2 cut(s) 294, 411
Eam1105I GACNNNNNGTC 1 cut(s) 114
EarI CTCTTC 2 cut(s) 294, 411
EciI GGCGGA 1 cut(s) 422
Ecl136II GAGCTC 1 cut(s) 614
Eco24I GRGCYC 1 cut(s) 616
Eco47I GGWCC 2 cut(s) 194, 218
Eco53kI GAGCTC 1 cut(s) 614
EcoICRI GAGCTC 1 cut(s) 614
EcoRII CCWGG 1 cut(s) 591
EcoT22I ATGCAT 1 cut(s) 662
EcoT38I GRGCYC 1 cut(s) 616
FaeI CATG 4 cut(s) 101, 127, 137, 442
FatI CATG 4 cut(s) 97, 123, 133, 438
FauNDI CATATG 1 cut(s) 445
FbaI TGATCA 1 cut(s) 136
Fnu4HI GCNGC 1 cut(s) 147
FriOI GRGCYC 1 cut(s) 616
Fsp4HI GCNGC 1 cut(s) 147
GluI GCNGC 1 cut(s) 147
GsuI CTGGAG 1 cut(s) 591
HapII CCGG 2 cut(s) 42, 197
Hin1II CATG 4 cut(s) 101, 127, 137, 442
HindIII AAGCTT 2 cut(s) 67, 547
HinfI GANTC 3 cut(s) 186, 368, 725
HpaII CCGG 2 cut(s) 42, 197
HphI GGTGA 1 cut(s) 479
Hpy188I TCNGA 3 cut(s) 246, 298, 502
Hpy188III TCNNGA 4 cut(s) 140, 431, 558, 570
Hpy99I CGWCG 1 cut(s) 506
HpyAV CCTTC 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 337
HpyCH4IV ACGT 1 cut(s) 206
HpyCH4V TGCA 7 cut(s) 28, 133, 149, 169, 636, 660, 702
HpyF10VI GCNNNNNNNGC 2 cut(s) 314, 699
HpyF3I CTNAG 1 cut(s) 402
HpySE526I ACGT 1 cut(s) 206
Hsp92II CATG 4 cut(s) 101, 127, 137, 442
Ksp22I TGATCA 1 cut(s) 136
Kzo9I GATC 2 cut(s) 136, 427
LguI GCTCTTC 1 cut(s) 294
LmnI GCTCC 1 cut(s) 611
Lsp1109I GCAGC 1 cut(s) 133
LweI GCATC 2 cut(s) 669, 687
MaeII ACGT 1 cut(s) 206
MaeIII GTNAC 2 cut(s) 106, 116
MalI GATC 2 cut(s) 138, 429
MboI GATC 2 cut(s) 136, 427
MboII GAAGA 4 cut(s) 311, 341, 377, 428
MhlI GDGCHC 1 cut(s) 616
MluCI AATT 5 cut(s) 179, 292, 452, 585, 626
MlyI GAGTC 1 cut(s) 180
MmeI TCCRAC 1 cut(s) 525
Mph1103I ATGCAT 1 cut(s) 662
MroXI GAANNNNTTC 1 cut(s) 372
MseI TTAA 2 cut(s) 284, 736
MslI CAYNNNNRTG 1 cut(s) 128
MspI CCGG 2 cut(s) 42, 197
MspR9I CCNGG 2 cut(s) 198, 593
Mva1269I GAATGC 1 cut(s) 662
MvaI CCWGG 1 cut(s) 593
MwoI GCNNNNNNNGC 2 cut(s) 314, 699
NciI CCSGG 1 cut(s) 198
NdeI CATATG 1 cut(s) 445
NdeII GATC 2 cut(s) 136, 427
NlaIII CATG 4 cut(s) 101, 127, 137, 442
NmeAIII GCCGAG 2 cut(s) 515, 654
NmuCI GTSAC 2 cut(s) 106, 116
NsiI ATGCAT 1 cut(s) 662
PciSI GCTCTTC 1 cut(s) 294
PcsI WCGNNNNNNNCGW 1 cut(s) 126
PctI GAATGC 1 cut(s) 662
PdmI GAANNNNTTC 1 cut(s) 372
PfeI GAWTC 2 cut(s) 368, 725
PkrI GCNGC 1 cut(s) 148
PleI GAGTC 1 cut(s) 180
PpsI GAGTC 1 cut(s) 180
Psp124BI GAGCTC 1 cut(s) 616
Psp6I CCWGG 1 cut(s) 591
PspGI CCWGG 1 cut(s) 591
PspPI GGNCC 2 cut(s) 194, 218
RsaI GTAC 2 cut(s) 481, 602
RsaNI GTAC 2 cut(s) 480, 601
RseI CAYNNNNRTG 1 cut(s) 128
SacI GAGCTC 1 cut(s) 616
SapI GCTCTTC 1 cut(s) 294
SaqAI TTAA 2 cut(s) 284, 736
SatI GCNGC 1 cut(s) 147
Sau3AI GATC 2 cut(s) 136, 427
Sau96I GGNCC 2 cut(s) 194, 218
SchI GAGTC 1 cut(s) 180
ScrFI CCNGG 2 cut(s) 198, 593
SduI GDGCHC 1 cut(s) 616
SfaNI GCATC 2 cut(s) 669, 687
SfcI CTRYAG 1 cut(s) 336
SinI GGWCC 2 cut(s) 194, 218
SmiMI CAYNNNNRTG 1 cut(s) 128
SmlI CTYRAG 2 cut(s) 556, 707
SmoI CTYRAG 2 cut(s) 556, 707
Sse9I AATT 5 cut(s) 179, 292, 452, 585, 626
SsiI CCGC 1 cut(s) 407
SstI GAGCTC 1 cut(s) 616
StyD4I CCNGG 2 cut(s) 196, 591
TaaI ACNGT 1 cut(s) 337
TaiI ACGT 1 cut(s) 209
TaqI TCGA 4 cut(s) 342, 426, 459, 616
TasI AATT 5 cut(s) 179, 292, 452, 585, 626
TfiI GAWTC 2 cut(s) 368, 725
Tru1I TTAA 2 cut(s) 284, 736
Tru9I TTAA 2 cut(s) 284, 736
TseFI GTSAC 2 cut(s) 106, 116
TseI GCWGC 1 cut(s) 146
Tsp45I GTSAC 2 cut(s) 106, 116
TspDTI ATGAA 3 cut(s) 17, 176, 638
VpaK11BI GGWCC 2 cut(s) 194, 218
XapI RAATTY 2 cut(s) 179, 292
XmnI GAANNNNTTC 1 cut(s) 372
Zsp2I ATGCAT 1 cut(s) 662
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.