Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000157.1

Orthogroup ID

OG0013123

Physical Location & Seq

Genomic Coordinates Forward (+)

44485 .. 45789

Gene Structure 1305 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000157.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 366 bp

atggatgcaagtaatgacataaagactaaggatgtgtcaatctctgcagaggcaagtcaaacaacccccacaagaacaaagaagctttttgtgactggcttatcattttatacatctgagaaaaccctccgagaagcatttgaaggctttggtcagcttgttgaagtaaaaataataatggacaagatttctaaaaggtccaaaggctatgcattcatagaatacactacagaggaagctgctgctgctgcactcaatgagatgaatggcaagatcattaatggctggatgatagttgttgatgttgccaagactagccctccaagatatagcaggggccaaagcagatcagcagcaaccagatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0005488 GO:0006139 GO:0006725 GO:0006807 GO:0006950 GO:0008150 GO:0008152 GO:0009266 GO:0009409 GO:0009451 GO:0009628 GO:0009987 GO:0016070 GO:0016071 GO:0016553 GO:0016554 GO:0016556 GO:0034641 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0046483 GO:0050896 GO:0071704 GO:0090304 GO:0097159 GO:1900865 GO:1900871 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RRM_1

Protein Analysis

121

Amino Acids

13.35

Weight (kDa)

9.4

Isoelectric Point (pI)

36.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013123)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G20930 AT3G20930
fragaria_vesca	FvH4_7g05760 FvH4_7g05760
malus_domestica	MD02G1255600.v1.1
prunus_persica	Prupe.2G080000_v2.0.a1 Prupe.2G080400_v2.0.a1
pyrus_communis	pycom02g21650
rosa_chinensis	RchiOBHm_Chr1g0332801
rosa_laevigata	RLG00000029643
rosa_multiflora	Rmu_ssc0000157.1_g000008
rosa_roxburghii	Rroxscaffold_4G00317970
rosa_rugosa	Rorug01G0103600
rosa_samantha	Rh1AG128400 Rh1BG097600 Rh1CG122200 Rh1DG134000
rosa_wichuraiana	Rw1G010500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	143, 164
AluBI	AGCT	3 cut(s)	85, 157, 239
AluI	AGCT	3 cut(s)	85, 157, 239
AoxI	GGCC	1 cut(s)	337
ApeKI	GCWGC	5 cut(s)	239, 242, 245, 248, 353
AseI	ATTAAT	1 cut(s)	279
AspS9I	GGNCC	2 cut(s)	198, 337
AvaII	GGWCC	1 cut(s)	198
BbvI	GCAGC	4 cut(s)	226, 229, 232, 235
BfaI	CTAG	1 cut(s)	315
BfmI	CTRYAG	2 cut(s)	45, 228
BisI	GCNGC	5 cut(s)	240, 243, 246, 249, 354
BlsI	GCNGC	5 cut(s)	241, 244, 247, 250, 355
Bme18I	GGWCC	1 cut(s)	198
BmgT120I	GGNCC	2 cut(s)	198, 337
BmiI	GGNNCC	1 cut(s)	338
BsaXI	ACNNNNNCTCC	2 cut(s)	304, 334
Bse1I	ACTGG	1 cut(s)	100
BseGI	GGATG	3 cut(s)	10, 37, 294
BseMII	CTCAG	1 cut(s)	108
BseNI	ACTGG	1 cut(s)	100
BseXI	GCAGC	4 cut(s)	226, 229, 232, 235
BsgI	GTGCAG	1 cut(s)	234
BshFI	GGCC	1 cut(s)	339
BsmI	GAATGC	1 cut(s)	212
BsnI	GGCC	1 cut(s)	339
Bsp143I	GATC	2 cut(s)	273, 347
BspANI	GGCC	1 cut(s)	339
BspCNI	CTCAG	1 cut(s)	109
BspLI	GGNNCC	1 cut(s)	338
BspMAI	CTGCAG	1 cut(s)	49
BsrI	ACTGG	1 cut(s)	100
BssMI	GATC	2 cut(s)	273, 347
BstDEI	CTNAG	2 cut(s)	27, 117
BstF5I	GGATG	3 cut(s)	10, 37, 294
BstKTI	GATC	2 cut(s)	276, 350
BstMBI	GATC	2 cut(s)	273, 347
BstMWI	GCNNNNNNNGC	2 cut(s)	245, 248
BstSFI	CTRYAG	2 cut(s)	45, 228
BstV1I	GCAGC	4 cut(s)	226, 229, 232, 235
BsuRI	GGCC	1 cut(s)	339
BtsCI	GGATG	3 cut(s)	10, 37, 294
Cfr13I	GGNCC	2 cut(s)	198, 337
CviJI	RGCY	9 cut(s)	85, 99, 147, 157, 207, 239, 285, 318, 339
CviKI_1	RGCY	9 cut(s)	85, 99, 147, 157, 207, 239, 285, 318, 339
DdeI	CTNAG	2 cut(s)	27, 117
DpnI	GATC	2 cut(s)	275, 349
DpnII	GATC	2 cut(s)	273, 347
Eco47I	GGWCC	1 cut(s)	198
EcoT22I	ATGCAT	1 cut(s)	214
FaiI	YATR	5 cut(s)	20, 111, 210, 218, 330
Fnu4HI	GCNGC	5 cut(s)	240, 243, 246, 249, 354
FokI	GGATG	3 cut(s)	17, 44, 301
Fsp4HI	GCNGC	5 cut(s)	240, 243, 246, 249, 354
FspBI	CTAG	1 cut(s)	315
GluI	GCNGC	5 cut(s)	240, 243, 246, 249, 354
HaeIII	GGCC	1 cut(s)	339
HindIII	AAGCTT	1 cut(s)	83
Hpy188I	TCNGA	2 cut(s)	118, 131
HpyAV	CCTTC	1 cut(s)	137
HpyCH4V	TGCA	4 cut(s)	8, 47, 212, 251
HpyF10VI	GCNNNNNNNGC	2 cut(s)	245, 248
HpyF3I	CTNAG	2 cut(s)	27, 117
Kzo9I	GATC	2 cut(s)	273, 347
LpnPI	CCDG	3 cut(s)	81, 271, 319
Lsp1109I	GCAGC	4 cut(s)	226, 229, 232, 235
MaeI	CTAG	1 cut(s)	315
MaeIII	GTNAC	1 cut(s)	91
MalI	GATC	2 cut(s)	275, 349
MboI	GATC	2 cut(s)	273, 347
MnlI	CCTC	4 cut(s)	43, 137, 226, 330
Mph1103I	ATGCAT	1 cut(s)	214
MseI	TTAA	1 cut(s)	279
Mva1269I	GAATGC	1 cut(s)	212
MwoI	GCNNNNNNNGC	2 cut(s)	245, 248
NdeII	GATC	2 cut(s)	273, 347
NlaIV	GGNNCC	1 cut(s)	338
NmuCI	GTSAC	1 cut(s)	91
NsiI	ATGCAT	1 cut(s)	214
PctI	GAATGC	1 cut(s)	212
PkrI	GCNGC	5 cut(s)	241, 244, 247, 250, 355
PshBI	ATTAAT	1 cut(s)	279
PspN4I	GGNNCC	1 cut(s)	338
PspPI	GGNCC	2 cut(s)	198, 337
PstI	CTGCAG	1 cut(s)	49
SaqAI	TTAA	1 cut(s)	279
SatI	GCNGC	5 cut(s)	240, 243, 246, 249, 354
Sau3AI	GATC	2 cut(s)	273, 347
Sau96I	GGNCC	2 cut(s)	198, 337
SetI	ASST	4 cut(s)	87, 159, 200, 241
SfcI	CTRYAG	2 cut(s)	45, 228
SinI	GGWCC	1 cut(s)	198
SspMI	CTAG	1 cut(s)	315
Tru1I	TTAA	1 cut(s)	279
Tru9I	TTAA	1 cut(s)	279
TseFI	GTSAC	1 cut(s)	91
TseI	GCWGC	5 cut(s)	239, 242, 245, 248, 353
Tsp45I	GTSAC	1 cut(s)	91
TspDTI	ATGAA	2 cut(s)	205, 278
VpaK11BI	GGWCC	1 cut(s)	198
VspI	ATTAAT	1 cut(s)	279
XspI	CTAG	1 cut(s)	315
Zsp2I	ATGCAT	1 cut(s)	214

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.